Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K07C11.2   

sjj_K07C11.2 RNAi JA:K07C11.2
Simmer:K07C11.2
PF:GL1_6F11
PCR_productsjj_K07C11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K07C11.2 Source_evidenceePCR871WS150 Sequence/Annotation Release
Chunk_score Abs_score745
Max_abs_score745K07C11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV82238798225561
K07C11.9 Source_evidenceePCR20WS150 Sequence/Annotation Release
Overlaps_transcript K07C11.9 Source_evidenceePCR20WS150 Sequence/Annotation Release
K07C11.2.2 Source_evidenceePCR793WS150 Sequence/Annotation Release
K07C11.2.1 Source_evidenceePCR871WS150 Sequence/Annotation Release
WB_DNA_textsjj_K07C11.21683acgtgtcagcaacgacactccgaaataacagagcgcgtgttgtttagcaatgccgctcaacaacccgccaagcaaaattcattcaaagtgactgcctttgttctaatttttgacgtgttcttgaattagtcgcgattttctttttcctttctcattaaattttttattcctcaattttattataatatttcaactcgcagaattacattaatcatgagcggaaaggaaaatactgctcctgtgatagacgatcagaaggccgaggtaattgttattaaaattagaaaggcatcaattctaatcttcaggttatttcacttacggaagatagcagacctcagagagttgaccaggcaagggaagaatcatggtgagaataattgatttattacttttacaatgtaatggactttagctggagtcttgatgattttgacgttggacggcctctcggaaaaggaaagtttggaaacgttttcatctctcgtgaaaaaaagaccaagcgaatcatagctttgaaagtactcttcaaaacacagttgcttcaacttggagtcagtcatcagttgaagagagagatcgaaattcaatatcatttgcggtatgttttctcgaagtcatctcatccaaatcaattaatcaatattatttcagtcatccgaatattctcactctttatggatactttcacgatgacaagcgtgtgttcgtcattctcgactatgccagcagaggagaattatttaatgtcctccaatcacaacctggacacaaagtgaatgaggtcattgccggaaggtgtgattttgtagatatttcagaaatatagtaaatttcctcagatttgtgcgacagctggccaatgcgttgcattactgccattcgaaaggagttattcacagagacattaagcctgaaaatcttcttcttgattcgaagctcaatctgaaggtacgcgtataaatatggttaactaagtactcaaaaagtcttctgcaatgttctcagtgcatcctttggttctccgagccgaaagaagtcactagctgaaaaagagtttatactctgatcacacagtaacattgcaataaaagcttagctcgagatgcgtgtgccgttctgcttttaatgcgatctggttccttttctcctcgggacaattaccgtaaaaattaaattcaacacattttatgcattctttctaaaaaataagacttgtatttcagcttgccgatttcggatggtccgtcgttgctgatcactcgaaacgccatacattgtgcggtaccatggattatcttgctccggaaatggtttccaatcagccacatgactttaatgttgacatttgggcaattggaattcttctcttcgaaatgcttgttggatatgctccgttcgccaatcaaactggtgataaattgatcgccagaatcaaggagtgcaagatttatgttagtaattatgaactaaatttgttagaatcttaataagcagttctccaacagaaatatgtgcatgaagtgatggtttgggtaaccatttcatcttttcatgtcatatatctcctgcctctcacggtttcatctgtgagaagcttcaaagaactgcaatagaagtctagctcgagatgcgtgtgccggtttgcttttaatgcaatatggttccttttctcctcgggac