Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_K07C6.14_b   

sjj_K07C6.14_bSequenceATCCAGACATCTTGCAAATCAAT
In_sequence (7)
PCR_product sjj_K07C6.14
smd_K07C6.14