Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K07G5.5   

sjj_K07G5.5RNAiJA:K07G5.5
PCR_productsjj_K07G5.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK07G5.5 Source_evidenceePCR789WS150 Sequence/Annotation Release
Overlaps_Gene K07G5.5 Source_evidenceePCR789WS150 Sequence/Annotation Release
Chunk_score Abs_score708
Max_abs_score708K07G5.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI71700927171783
Overlaps_transcriptK07G5.5 Source_evidenceePCR789WS150 Sequence/Annotation Release
WB_DNA_textsjj_K07G5.51692atcgccagaagctcagaaaaaggttgatgagttttataataatcaaaaggagttgcttcaaaaattcgatgaagaccagaagactattggaaaaccattgcagaaaactgcggtaaagttgtattattgattttattgtaggctgtctctagacgcaaataaatatttaaaatactacatattttcgttttctcttatttgtctatttatctttacggtgaattataattttcgtataattttgaagttttcaggaggaggatgaaagatatgaggaccgagttttggctcaagctacttttgctctaaacattggaagtttgattggtaatttagcggcatcgattatttctggatcattgtcaatcatgaggtttgttttttttgtaggtaaaacataatgtcatgcgacatgtatacgacatgtatgattagtaaatataaatttatacaatccaaaagtaaactagaaatttaaaaatttaacatcaaaattaaaaataaagcatcaattaaaataatagttttatgtcaataacaatgtttttgaattaatttcagaaagtgccaattaccaaggtcagctaccactgctatttttaaaatatcaaaaatagactttcaaactaaattacgttgattcaagacagcaaaacactaataattcgccaaaaactagaagtacctgtgcattataactgatttcaccaatttttgtctactctattcaaattgaaaaaggaacataataacaagacatccacaaacttgacaaaaaccaatgttatccttatccaactttacctagcattgttacccgtgcataagttcaacctttcggcccgagaattgattattttgaaaatgattaaaaaccgctttacagtacatttgtggactcttcaatggatattgcctgcagctttgtcatgaatatttgtctgagtgaaatcaacaaaactgacgctcaaaaatatccacgtggaagagatcgactagaactgataggagttatcctatgttccgtgataatggcatttgccaatgtgtcaatgatcatgcaatcaataaattcaattgtaaatgacacagttgatccaaaaatgaccaattctacgattgcaataattgtgatacaaactgttttgaaaggaattataatgtggttttgttataaaagaggatcaacttcaagtttagttattgcaatggatttgagaaatgatttaatgacaagaagtcttgcattggtatgtggttaccttggagattatgtatggaaatttgctgatccaattggagctatttgtgtatgtacttggattgcatattcttggtgtcgtcatgcaattgataatattccacaattggttggtattacagctgaaagggatcaattggccagaattttaaatattacattgaaacatgacaagagaattaagtaagtatcattttcgtaaaagaactggaaaaccggaaatgcgcttttttaagtgccaatattcgagtttttattctgctttacaattcgtaaattccaatgtccagttagtgcgatagactcaaaatgattaaatattttggaaaatagcattcaaaaacatttaaaaaaattattggaaaactcccgtaacaacgaaaaagctgactactgatagtttagaatccggtaaaaccagacgctcgagc