Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K08C9.1   

sjj_K08C9.1RNAiJA:K08C9.1
PCR_productsjj_K08C9.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK08C9.1 Source_evidenceePCR723WS150 Sequence/Annotation Release
Overlaps_Gene K08C9.1 Source_evidenceePCR803WS150 Sequence/Annotation Release
Chunk_score Abs_score698
Max_abs_score698K08C9.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1148478811486471
Overlaps_transcriptK08C9.1 Source_evidenceePCR803WS150 Sequence/Annotation Release
WB_DNA_textsjj_K08C9.11684gacagatcaagttaattttgccgtttcgacgattcatcactagaatttgtgcgggatcttgcaaaagacttcgacctgaaaatattgataatttggttgaaaactgaaaattagggtaaagtttaggcgtagtcgtaggcgtagtcttaggcgtaggtctaggtctaggtctaggtctaggtctaggtctaggtctaggtctaggtctaggtctaggtctaggtctaggtctaggtctaggtttaggcctagatttaagctcaggattaggcttgagactcgcttaccgatccatcgtcgcggtgaggttcaccagtcactggatcatacaagaatccgcccatctcaagtccttcaaatccattattatcagttggcatgacacatgtgaacaagtcatcatcaacatcatatgtcccaatgcattttctgtagttggatccagccttgtatgtcatgagcacacgttctccgtatcgaaccacgtaattgccggcgtcaggcgtcttgaatgtgttttccggtcccgtgcaaacattatcaagagtttgagatttcttgaatacggttttttccaagctgaaattaaaattttttgatattaacttcaacgcgccatatctagcttcatttcaatgataccaattaacattcaattacaaaactatagagaaataaattttaaacattttctcagttgaacactttttgctaaaagcaaaaccagcggagatatgagctcgcaaacaaaacctacttgacaaagtcggcattcaacaggaaatactccatattgcacttcttcacgacattgattcctttgaacggcatacaaaagtttgacccgcttttttccaagtttggaatgtacgtttcctcgattccggaaaatgtgaagacgccgtcgagaaggctgaaaaatcacaataatttattcaaaaatcgataatttcatcaaaaaatcgataatttgctcaaaaatcaaaaatttcatcaaaaatttcatcaaaaatcaataatttcatcaaaaatcaataatttcatcaaaaatcaataatttgctcaaaaatcaataatttcttcaaaaatcaataaaatactcaaaaatcgatatatccgctaaaaaatcaatattttcccacttacataacgccaatcattgcgtatttataactatccctgttgcctgtacgcaaattgtccaccaaaatcatagtgttgtggaaatcaccttcggccgccggaacaaccatctgaaaaatggatttttatgagaaatttctcaattaaattatcgattttccgagaaattttcgattttttatgaaattatcgatttttccggaaattatcgatttttcaagaatttatcgatttttcaagaaattatcgatttttccagaaattatcgatttttctggaaattatcgattttccgagaaattatcaatattttctcaatggagcgcacttactcaccggttttttcaattcgaagcccacttggtacatcgggttgctgtgctttggcttctgggtcgccgagtctgctgccaacgagaattgcacaagttggagcatcaaaaagactgcgagaaatgatgacgtcatcgtgttgaggcggcgagtttcggttggttgggttatccaattcacaccgatgaaaatccgatgaatgaaaatc