Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K08C9.6   

sjj_K08C9.6RNAiJA:K08C9.6
PCR_productsjj_K08C9.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK08C9.6 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene K08C9.6 Source_evidenceePCR384WS150 Sequence/Annotation Release
Chunk_score Abs_score321
Max_abs_score321K08C9.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1149778411499162
Overlaps_transcriptK08C9.6 Source_evidenceePCR384WS150 Sequence/Annotation Release
WB_DNA_textsjj_K08C9.61379gatcatctttctttgccattttgacctttctatcaaattcctacttcgaaaattttactgaaaattcacgaaaaataaacgtcggaattaaaaaaaaaattaacggaaaaaaggtctgtataacagataatttttaatcgattattttcaaacaaaaagaatcagataaatcattggagattgctggcgcattttgcgtgctggtgtatttcttgttccggcgtctccgctttctgcacacacactctccgtgtctaacttgatttttctaatacgaaactcagcaaagtcacagtttggtgaaaattctgagttttcaggattatctggaaaaataaaaaatagtatagctatttctatttgaaaaaaaaaacaatatcaattttaaaacaaaaaaatagcgataaaaattgttctactatttgtttttcggagtgggtaaatgaattatgttcaaaaaagtcataatattttttgaagctcaattgaatttttggtcctttggcaaaaaagcgaaatttcacatgcagattatttggaactcggccataacctttttacttttcccctgtaaacctataaaaatttcagacttgagaaaaactatgcagaacgattcatttatagtcaaataaacttttcatgattaattatctaagatctgaacattcccgtgatagccttcataaaagttccaagttgtccccaaaagtcagctccgtcctctccggggagcaaaagtccatccaagtcccgatcgaagcatctgtagaatacatccgtgaacccaatgtactgttcggcaggtatcgggctacggtttctgtttgataccgaacagtattgctgaaaacaaaattggttaggcattgaggaggcgtagagtaactcaccactgcagatttttcatgcgaatccattatatcctcccaaatagatgagaaatttttcacaagattctctaaaggtgttctccctgctgcgtttgaaacttgaaaaaggcaaaaaaatcacaagaaaacagaaaataaaccgcattttttgtgattttgtgaagttttacagggaattgagagcttttatatgtatatcatcaagaaccaatgttcagaccttttatcaaaaaaagatcaaataaagaccattcaaaagtacaaagaaatcttatacattccggtaatggccctctcgaagattccataaaatccccaatagttctcgttgatacctggcaacaggaatccatcaagatcgcggtctttgcatccgtagatccatggcaagaagccatcgtaggcgttgtttggttgtggcgtatggttcatgttctcttcacggcagaagttctggaaaatagttagcgcaattttcgactagaa