Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K08D12.h   

sjj_K08D12.h RNAi (2)
PCR_productsjj_K08D12.h
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS K08D12.1 Source_evidenceePCR720WS150 Sequence/Annotation Release
K08D12.3b Source_evidenceePCR129WS150 Sequence/Annotation Release
Overlaps_Gene K08D12.1 Source_evidenceePCR816WS150 Sequence/Annotation Release
Chunk_score Abs_score753
Max_abs_score753K08D12.1
Specificity_index0.624
Rel_score1
Map_statusBest_ePCRIV17087871711017
K08D12.3 Source_evidenceePCR563WS150 Sequence/Annotation Release
Chunk_score Abs_score458
Specificity_index0.376
Rel_score0.603
Map_statusTop50_percentile_ePCRIV17087871711017
Overlaps_transcript K08D12.3a.2 Source_evidenceePCR556WS150 Sequence/Annotation Release
K08D12.1 Source_evidenceePCR816WS150 Sequence/Annotation Release
K08D12.3b Source_evidenceePCR376WS150 Sequence/Annotation Release
K08D12.3a.1 Source_evidenceePCR563WS150 Sequence/Annotation Release
WB_DNA_textsjj_K08D12.h2231tgaaacgaaaatgatgacaagtgtgaattttcataaatattgagggaaatcaaataacttagcagtatagtcgcacaggggaaaatacaatagaagatcgaaaaacgaaacgattttagaggacttgttcgatgtgcggtgggaaagagagatgtggagttggtgtctgcacgaatgggaatcctggtttgtcgggacggaacagctcgaactgtgagccggctttgttgatcacggcgagacggacaactccgccggaggatccgtcacggaaggtggcgagtccgacggcttgcttcacgatcgccttgcactcctcgagcgtcaagtttggtctccattgactgtcgaggaagccctgcacgaatgtggaaccggagccggaagctgtcgatcgctggcgggacacgaatcctccgattgggattgcgtagacctggccgccgagctcctcatcccagccggcgacgagcactgaggcggagagctgctcgcggtagttgtagaggaattggcggaaaatctggctcgagcggtagattgtcactggcttgttctctgtcatgctgaaaaaagtgattatttaaaaaaattattttatttaattttaaaacaactgaaaattccttacgtataaacatcaatatggtacttggcaatatcggcgatcgcttgagtgtccgctgcagatccagaacggcacacaaccatattatcggtgatcggggtgattttgttggtggcacgggaggtgatgaacgagccggcgctggttctcgagtcggttccgacgacaactccaccgttgtactccatagcgatgagagtggtctgaaaattgagcttttagtggaaatttcaatttaaaaatctcactccagtgctgatttcttcctgtggatagaacccgattgccggaatggctttgcgcttctcatctcgcatagtatccattatctgcaaaatatcgacttaaattcattttttaaaagttattttaacgttaagaaatcaataataatgtataaaaacaaatttagtagttatttttcagaataaaatcattaaaaacgagaaacccgagcagaaaaaacattgtcatcaaatctcaatgcagcaaaaatgacgtttgaattggcgctccaccggactgcctgcacatctaactttcctggcacgcggccaacattcgattttgggacgatcgacacgttctggccacattttctttgattttttctgatttcgccgacttttttcccgttaaaactggtttttataactagttttccatgtatttattagtttttgtcatgttagtcactgaatatccatgatttctcgccctcactgtcttggatttttgtttctctgaattttcgccatttttgattgaaattgtgacattcaaccgtttatttttttgtaattcctcgcaactgataatttcttttttctaaaatcaattatttgcagtaatgtcggacagaaattgctacaagtgccaacagccgggacatatctcccgcaactgcccgaatggcgagtccgatggtggacgtagaggaggtggaggaggtggagtggtgttgaatttggggtgttgagttgatttaggtaaatacattatctcttgatttcttaccgaattgcaataatttttgaagttctggagaagtggaggcgaagagaaatgtgtttaagctggcggagattaggagttatttgatgataaatttacagcggaaatctcgagactaatttcatgttatttcaggatccacctgctacaactgccaagagactggacacttctctcgcgattgccccaagggaggatccggaggaggacaacgtggaggtggcggcggcggtggatcgtgctacaactgcggaggacgtggacactactctcgtgactgcccatccgccagatctgagggaggaagcggtggctacggaggccgcggtggagaaggcagaagcttcggcggacaaaagtgctacaattgcggacgctccgggcacatttcccgcgagtgcaccgagagtggctcggccgaggagaagcgttgctaccagtgccaggagaccggacacatctcccgcgactgcccaagccagaccaactaaatcaatcatcattccccccattttcgttgtcttttcattgttctgtaactcgaaataatgtattcaactgaaactttcgttcactcctttttccaata