Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K08E3.5   

sjj_K08E3.5 RNAi JA:K08E3.5
Simmer:K08E3.5
PCR_productsjj_K08E3.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (5)
Overlaps_Gene K08E3.5 Source_evidenceePCR1054WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII1376372913764909
Overlaps_transcript K08E3.5a.1 Source_evidenceePCR978WS150 Sequence/Annotation Release
K08E3.5d Source_evidenceePCR978WS150 Sequence/Annotation Release
K08E3.5c Source_evidenceePCR978WS150 Sequence/Annotation Release
K08E3.5a.3 Source_evidenceePCR978WS150 Sequence/Annotation Release
K08E3.5e Source_evidenceePCR978WS150 Sequence/Annotation Release
K08E3.5b Source_evidenceePCR978WS150 Sequence/Annotation Release
K08E3.5a.2 Source_evidenceePCR978WS150 Sequence/Annotation Release
K08E3.5f Source_evidenceePCR1054WS150 Sequence/Annotation Release
WB_DNA_textsjj_K08E3.51181catataaacggcactactgagggactgtgagagaaaaggcgaatgtaatgaaaaatcaggaataaccctataaaaattagtgctccaaaatgcgcaaatttccagaaacaatcttgttctccagaatcgaaccaggcgggatatcgatacgatctccgtggttggcaatgatgatgacggtgccctgaaattgaaaattactgatgacctatatggaaaaattcaagttaccttcaaagatacatcctttccgaaccagacatcaccagaaactgtcaagtgatccagctcgagaagatcagggattccattgaaccgtcccaggtagtccttgaccttatcgaatgaagatccgagcttcaccagcggtgttgttgggaaggatctttgatgagacagcgtcaaggatccattgtcaatatcgtaaagatttgacattaaaagcagaagatcagaagtcttcttgactggcaagaaacgggaacgtggcacattgactccaacagctccagagaatgacttgatggctgcaccagcggcggtttcgagttgaataacatcaagcccacggtcgagatgcttcggattgacgataacctccatttcgagcttgttttccaccacaatttttctcatggcgtcaagcttggcccacaagttgttagtattgaaaattcggaatttgctaatcgacttgaactcgtccacataatccttcggcacctgagcaatttcaagaagcataagacgtccttcgtactgaatgagagttcctcccttcacgtcagcacgggtcttatcggtgacctccatcaagaactccggagcagtttgatcgggagatgggttcagcacaaaattgagaatagaaagatccacggtagctcccatattgtcaatgttggataggaaacagtattctttgccgtcggcgaggaacttgtccaggagtccagagttgtggaaggcctcgtagaagtttccgtgacctggtgggtaccagcattcgttgtcgtcggcttcgagtgatttgacgattggaagaagagtctcacggttgatacgtgggtattgagattgggagaaggtatgcacggagacctgaaagattgtgtatgaatttaaaatcgaaagtttccgaattcgtattattgtgatgtaagtcgaagatgccataatgc