Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K08E3.6   

sjj_K08E3.6 RNAi JA:K08E3.6
Simmer:K08E3.6
PF:GL1_2G3
PCR_productsjj_K08E3.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK08E3.6 Source_evidenceePCR928WS150 Sequence/Annotation Release
Overlaps_Gene K08E3.6 Source_evidenceePCR928WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII1376966813770809
Overlaps_transcriptK08E3.6 Source_evidenceePCR928WS150 Sequence/Annotation Release
WB_DNA_textsjj_K08E3.61142tggtttgtcctggtgtttgatcgcatgatggaatacttccacagctcaagctcctgcgggtgagctggcggtgaagtgagacacgtggcgggtcctggttctgagctcgagagttatgaatagtagtggtggtggtggtagtggtggtagttgtcatttcttgatgaggtgtagaaccatcatcacggcatctttttggaggtgtaccaccctcattctgaaagaacaaacgcaattcaacaaaaactgtcatgtcataatttttaccggctcttcatctatagtagctgtcataacacggcttctgctcctcttcgaattggcagcagcagtaatcgcatgtgctgacgcgcttctccgcttgccaccaactgcgtttccagcagctgagcttcttctgacctctcttccattgcgcaaatgaataacttcctcgaaactgtctccagtttcatcgtaatccacctcactatcgtcctcatcgtcctgtgtgtcctccatcaaatgtggatgcctctgctgcacccgtttcgagtatgtccggaccagtggctcgtgaagaaacttgaactgatcgcggtcttccttggtgagactattgaatataccgttcttcatcgcatctttcagctgcttttcacgagtctcgtagacgtttagatcgagcttcaacgccttattttcttccatcaacgcgcgtaaatgtttctgagtgtctttgacatcgatatcgaacattgccagcttcttgcgagcttttctgaaataatagtgttttctaaacacgtaaacatgaaatatttcacttacgcaagtgcttcttcggcctctctcatatctgcattcagccgctttttggattcctcggaatctttccacagcttgcggagacgctcaatctcatcaatcaaatgaaacattcctgaaacacgtcattaaaatttgaaaatgataattgaaactaacctatatccttaatatcgaattgcggtcgctgtgagtttagaatcatgttgaaaatgtgacgcgagttttcgccgcacaccttctcttttgatgtactggacttcattctaaaatgtggaaatgattagaaaacgagaaactcgcccgaaaataagagaaaaatgcgtgaaaaccgt