Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_K08E3.6_f   

sjj_K08E3.6_fSequenceTGGTTTGTCCTGGTGTTTGA
PCR_productsjj_K08E3.6