Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K08F8.1   

sjj_K08F8.1RNAiJA:K08F8.1
PCR_productsjj_K08F8.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K08F8.1 Source_evidenceePCR743WS150 Sequence/Annotation Release
Chunk_score Abs_score699
Max_abs_score699K08F8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII87449378746012
Overlaps_transcript (18)
WB_DNA_textsjj_K08F8.11076cagaatcacgccatgagctaagagtttgattaggtttctgtctcttttccattgatcctagaaaaaaattgatgaaaatagaagctggtgattgggggttaagaaaagaagagaataattgattcgcaatgcaaagaacaactaatctgatcaggttttttttgaacactcagtgtcaaacttgtgacctattgtaacattttgtttttgaataacaaattgattgctctttcagcgttcattggttctgaatgcaacaacatcgttgaacattgactgtgacttgtcatctgatgatgatcttagcccaacaactcaacgcaagatttgtttctgcgccagccagaatccagcggaaactcaagaacaaggcctccgtccagcaaagtcgacattggccatctcgttcccgtgtcaccagcaccaaatcaccgaggactataccatttctgccgaaattattggaatcggcgaatcgggaaaggtgatggcgtgctaccagaaggttaccggtgaaaagtttgcacttaaagtgctgagagatagtcagaaggctcgacgtgaagttgagttgcactggctgaccaatgcgcatgaaaatgtcgtttcgattcttgacatttatgaaaacacttttgacaatgtcaaatgtcttctgatggttgttgagtttttggaaggaggtgatttgctcagtcaattcgagagtcaaggaagcattccatatactgagaagagttagtttaaacaattatatcttccaaaattaatttcaattattttttcagaagttggtgaaattatccgccaaattggtaatgctgtgatgtaccttcacgacatgaatattgcacatcgggatatcaaacttgaaaacattttgtgtagtggtacgggtgacaattgtgtctataaattgggtgattacgggtttgccaagcgtccagagagaaatgtcctcatggagtcgccatgttgtactccgttctacgcgtaagttctagaatgttttgtcttctagattctataaatcttattttcagacctccagaagtattgggtcgtgaacgatatga