Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K08G2.8   

sjj_K08G2.8RNAiJA:K08G2.8
PCR_productsjj_K08G2.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK08G2.8 Source_evidenceePCR848WS150 Sequence/Annotation Release
Overlaps_Gene K08G2.8 Source_evidenceePCR848WS150 Sequence/Annotation Release
Chunk_score Abs_score787
Max_abs_score787K08G2.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1586888515870042
Overlaps_transcriptK08G2.8 Source_evidenceePCR848WS150 Sequence/Annotation Release
WB_DNA_textsjj_K08G2.81158acttgcatttttggtcagccgctttagacttgtcaattagttttttggctcagccatttttctgtacaccgaccatggctgctttcccacttggcgttctgagtttaattggcgtgcctaatgatcttctgatgttgtcaatatataccattttcatgcgtgagttcggatttcagaacgcttgtgaaagctcgacccattatttaaggccagaaaccggttctggggtgtaagcctctagccggtgccacgtagtattggttgttaagaatgaaacatgtaaaaaatatttcagttgtcccagtatccatcatctcaatgttcgaaaatcgctacttcgtattatttgtcaaccgcggctgctggcgatacttccgataccccttccttgttgcaaattatataattgtcatcacttactgcttcatcatatacttagaaattcctgatcaagagattgcaattaaaaaactattcaaaaagtatcctcgattttataactttgaaattcctgtgtcatcatttatcgttattagtgatgaggacagatcctggcaaaagttacgacgaatatcagttataagctttattctgttggagataatagtttttggaatattgttacgagtaaaattgaagctatcaatgaagaaaattgcatcttctatatccagcaagacacttcaaatgcaaaaaagatttatcaaagcattgaatctccaggttaattagttgatgaaaaactttttttttcgaaatgtcatgacattccagattgctattccactgattgttatattcgttcccataatagctggtatgatatttaaagcattgtcaattgtgaaccctcaagccttcagtaacttactcaatttttacttttctcttcatggagtattatcgacaattctcatgctctatctacagaacccctatcgtgaagcggttttgtccattttttgctgccgaaaaccagttgaatcaaaaatattcactactgcagggaaatttagcaggaaaagcatgacatgaaatttttttttgatttttgatttatttaattgcaaaaatgaactttgttttttttatttaatgcactgattttctctttttataaaaattttcgaaaatttatatcggtgtacggtagttcgc