Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K08H10.8   

sjj_K08H10.8 RNAi JA:K08H10.8
PF:GL1_8D9
PCR_productsjj_K08H10.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C27H6.8 Source_evidenceePCR962WS150 Sequence/Annotation Release
Chunk_score Abs_score879
Max_abs_score879C27H6.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV99892199990379
Overlaps_transcript C27H6.8.2 Source_evidenceePCR960WS150 Sequence/Annotation Release
C27H6.8.1 Source_evidenceePCR962WS150 Sequence/Annotation Release
WB_DNA_textsjj_K08H10.81161aatgaatccggaaatgtggacaaagactccgcctgggattccactttccttcgaaagatcgtcatcacggagaccacgccaagcagctggaagtggcatgcgattctcgaatgatgacattttgtcgactgggattgcttgaacgcgccacgaagcattggtagaatctagaaaacagataataattattgaattttaaaaaattaaataatttctaacccgagaacagaatgtaagtgatattatcgtcggcaatattcttctctacttcaatgtcgaaaaagtgttctttccacgggcatccaccgttctcgataagaatgatccttccagatgcatcaatttcaaatcgtttatccacagcagcttcgatgatctctctagctggccaccaaacatttgccaagtacttcactgatcgtgaaaactcttcaccgatgaattgcattgcttgttggaatcgttcatcagcatcattctcaggttcattccaatgggaattgaattgaccagtacgcgatgaaagatttcctgatgaatgatatcttggaactccgtcgtattgagaaatcccgttatcaatggcgtcgattgattcaacgaattgctcgtagagacgatgatagaatagatcaatcatcgaggatgacacatttccaccaaggatctgaagttaatagtttcaaaacaaccttttgattattgaaagttacctgattgatgacttctctcccgtagtgagcgtaaactaatcctgcagagcttagttttgtatcaaagttaagcttctctagagtacgcatggtatcagtgaatccacgttgatgatgatcgtatcgttgttttgaatgatcaaagattccaccgacatcgacgataatatcacacttctccagttgagcagcgtcacgggttctgaaattacagatttcagaactcagctataaaataaatcctaataaaaaagtgggtcatttcgcaaacttgataaacatgaaaaatcgaattaccttaaaatcgaatgatccttgaattgtggcaattgtttcagcatgaaacaagcaaaagcctcatcgcaatggaattttccggagtgagtaccaatgagcgatgtcatcttgtgaccgaactgtccaagaagtcgtgaaatcacctgcagag