Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K09A9.1   

sjj_K09A9.1 RNAi JA:K09A9.1
Simmer:K09A9.1:Repeat_a
Simmer:K09A9.1:Repeat_b
Simmer:K09A9.1:Screen
PCR_productsjj_K09A9.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK09A9.1 Source_evidenceePCR701WS150 Sequence/Annotation Release
Overlaps_Gene K09A9.1 Source_evidenceePCR704WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRX1560771215608644
Overlaps_transcriptK09A9.1 Source_evidenceePCR704WS150 Sequence/Annotation Release
WB_DNA_textsjj_K09A9.1933attcattgtgaaaccctcgcagccagtaatgtttcgcaataacaccccttcattcttaccaattctagggttatcattctttgcattttcttgtctgtagtctaccaactttatctcatttgcttcttctccttttgtaacaatgttccctaaacattattttttttgtttttcagggtatggctcgtacaaaatgcaaaaccaaaaccgtagccaatcctagaactggagtcagaaaaaccgcaaaagatctttctgaaccagttcgtcaggatgccgtttcaagaaggaggcccacaactcttccttttgttggaaatacctcaagtcgtccaagggtgttttacgatgttctagccaagaagaatgtcgtcttcccaaatgtcaaagcagagtaccactatagagttcgcaatgctccgaagattgatccaaagaattttggcacgacgcttccaatctgctattcttcaatcggacctgcaaaaacacttgaacttcgtccactgggtcgtctacccccgcacatcatcaaagcgttgaatgatcactacgtgcaactgacacgtggatctatggttccggctgcggatctatataacaatggagatcatccagcagaacaacgcataccaacaatgttgaatgagaatgagtacttgcgtttgatccaggaactcgaggaagaggagaagtcgaagcagttttcagctacatccagctccgcaccacatgtgaacccatatagtgcccaacacttggtgagttgaaattaaaatttgaaatcttctcattcaaaagaatcaatgttaaggttaacggtgaaattatcggaatctttgtcatttatggaactggtcttgttactcgcgctgtttgctcacaaactcgcgaaatgtttaccgctcacgtgcttcctgaatggaaagcgtc