Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K09A9.1   

sjj_K09A9.1 RNAi (4)
PCR_productsjj_K09A9.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK09A9.1 Source_evidenceePCR701WS150 Sequence/Annotation Release
Overlaps_Gene K09A9.1 Source_evidenceePCR704WS150 Sequence/Annotation Release
Chunk_score Abs_score662
Max_abs_score662K09A9.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1560771215608644
Overlaps_transcriptK09A9.1 Source_evidenceePCR704WS150 Sequence/Annotation Release
WB_DNA_textsjj_K09A9.1933attcattgtgaaaccctcgcagccagtaatgtttcgcaataacaccccttcattcttaccaattctagggttatcattctttgcattttcttgtctgtagtctaccaactttatctcatttgcttcttctccttttgtaacaatgttccctaaacattattttttttgtttttcagggtatggctcgtacaaaatgcaaaaccaaaaccgtagccaatcctagaactggagtcagaaaaaccgcaaaagatctttctgaaccagttcgtcaggatgccgtttcaagaaggaggcccacaactcttccttttgttggaaatacctcaagtcgtccaagggtgttttacgatgttctagccaagaagaatgtcgtcttcccaaatgtcaaagcagagtaccactatagagttcgcaatgctccgaagattgatccaaagaattttggcacgacgcttccaatctgctattcttcaatcggacctgcaaaaacacttgaacttcgtccactgggtcgtctacccccgcacatcatcaaagcgttgaatgatcactacgtgcaactgacacgtggatctatggttccggctgcggatctatataacaatggagatcatccagcagaacaacgcataccaacaatgttgaatgagaatgagtacttgcgtttgatccaggaactcgaggaagaggagaagtcgaagcagttttcagctacatccagctccgcaccacatgtgaacccatatagtgcccaacacttggtgagttgaaattaaaatttgaaatcttctcattcaaaagaatcaatgttaaggttaacggtgaaattatcggaatctttgtcatttatggaactggtcttgttactcgcgctgtttgctcacaaactcgcgaaatgtttaccgctcacgtgcttcctgaatggaaagcgtc