Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K09B11.10   

sjj_K09B11.10RNAiJA:K09B11.10
PCR_productsjj_K09B11.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK09B11.10 Source_evidenceePCR787WS150 Sequence/Annotation Release
Overlaps_Gene K09B11.10 Source_evidenceePCR787WS150 Sequence/Annotation Release
Chunk_score Abs_score745
Max_abs_score745K09B11.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1343952513442300
Overlaps_transcriptK09B11.10 Source_evidenceePCR787WS150 Sequence/Annotation Release
WB_DNA_textsjj_K09B11.102776caaggaccaaactttcaaacaacggatttctactacaaagctaactagtaagctactaactccaactataatatttgaagtcaggctactattaagaaaataagcggtaggtaggtatgaaggcacgcctgcctacccaaactcacctcatatactcgacatcaattcgcccattatatgagcatggaaccattctcgatctcaaatttgacacagttgcattttgcattaaaaacactgccacatttcctttgactcctttaggaactgggaacacatttgaatctcttggcataactccatacttgacaactccatcgtagttgacccactgattacagtagtctttggtaaagtcacagtttagtgataagtcataagggacgtaacgaccgtttccaggttggagaccaaatatatgttggatctggaatttatttattttgaatgtgtcgttaaaaaagtgttttatcctaaaataacttacaactggcgggctaattgtggtgacaatcggaggagcaggttccgtgcaaagaagtccaccaactcgaagttccgaaatagccaataacccaaatgagctttcatcgaatgcaatgatcccaacagtaaacttaaatggttgagcataagaatccaaatcaattgtgattggtccaggactatcatttggttcaagatatgcacaactcaatgcaattccatcctcatcaactgcacatatctctgcttgagttccagttttcatccaatatctggaaaattgtagaataactctttgaaagagcagtcaattactcaattacacactttaaagataggcttgtggttctctgagagcatggaataacttgactggttaaagtagaatatggacggggagaaaatgaatcaactgccaagaaaaggaaggaagagtttggatgggattggttggctgttatctgaaagaagcaatgtatatgttcagctagatttatgaaatattattgaaaaaatttggaacgcttcacgaatttgcgtgtcatccttgcgcaggggccatgctaatcttctctgtattgttccaattttagtatatgttctcggaagaacaaacatttagatttacatttcaattatatagggaccatttaccatgcagctgacatattgagagtcctgtaagacactataccaaatggagacgtagatcaataatttgtgcacctatgctatagcgataccaatatcgatttgcatctccacttccctagcatagtcatagtgtcttacataactccaaatatgtcagctgctgtgtaaatggtccctatataattgaaatgtaaatctagatgtttgttcttccgagaacatatactaaaattggaacaatacagagaagattagcatggcccctgcgcaaggatgacacgcaaattcgtgaagcgttccaaattttttgacgattttactagatatccctgtttgatgcccatttttatcatcaacttatggggttattcaagtaatgtagcaaaatgtatttaaatacatgtttttatatacttgaataaggttgtgacgtgtaatttttctacactttttaattttccgacactacttgaataaccccattattaagtttcaagaaaaggtgtatttatacatagaacaatttttataatccttcttaatttcaaaattccaaattttttgagttcattgtttcagccaactttggcaagtctccggattgaaacttctgaagctgccaaataagcctatattgttgcaaaacatttaaatagaagaagtcaaaagttttattagtagaagttttggaaatattccaagaacgtatgaagaaagtttgtcggccgagagtattcagctgttgaaattttcaaaacgtgtggattgcccaattattttttaacaaacagttaaaaaggccacttcatagagatgaatacctgtctaatgcttcatacaactcatttttcatcacttttctgcactttggatgggttttaaattattgacatactgacgaaaatttgtttttaccgtattccctctattagtattgcaccccactacttaactttgaactcggttcattttgaagatatcaatgtattattaactacgaaatgatagaaataaagttaaaaaatattttgttagttgacaattttttaataggacaaacgatgactgagatataagctgtgaaagttgaacaatggggtgaagtactaatggggttattcaagtaatgtagcgaaatgtatttaaatacatttgtgacgtcacaaatgtatttaaatacatgtttttatttacttgaatacatgtgtgacgtaatttttctacactttttaattttccgacactacttgaataaccccataatagaggaaatacggtaattaactttagtggttcgatcccatatttcgcttgaagatatcaatgcttcaaaatgttgtttaaaaaattatcttatttccaagatttaattaaaacaaacctcaaacatatcaacccatcgatcaattgatctaccaactctccattcacttaattgagatttggccatatttccccatcgacaggatcgtagcgggcgttcacaactcaaatcagacattctttgaagtggactattatcatatggaggaatacgaagagatgagaatgatgatgggaatgctggaataattaattttaggtaaaatgggagtgattgagatattttgttagattatgaagagtgaggcattgg