Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K09B11.2   

sjj_K09B11.2 RNAi JA:K09B11.2
Simmer:K09B11.2:Repeat_a
Simmer:K09B11.2:Screen
PCR_productsjj_K09B11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK09B11.2 Source_evidenceePCR601WS150 Sequence/Annotation Release
Overlaps_Gene K09B11.2 Source_evidenceePCR601WS150 Sequence/Annotation Release
Chunk_score Abs_score517
Max_abs_score517K09B11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1342452713426409
Overlaps_transcriptK09B11.2 Source_evidenceePCR601WS150 Sequence/Annotation Release
WB_DNA_textsjj_K09B11.21883aagattttcggcttcaaattttcagaaaattcaaaaaaaaatgcaattttttcagaacttcctgattcattcatcaatccagaagcaaatcatcttaccgccacattttttcatcagtcgtgatgattttattatttatccacaacaacaagaagctcaactcaaatcacaaatgaatcgtctgaataagcttcgaagtaggaatatttctggaaaatactgaaaataaatctgaaatttccagacgacggacagaggactacaatcttgccgatcgggcataaaggagctggaaaatcgaatttaatgaggagtctggttaatcgatgtctttcaaagtgagaatcgctttggaaatggatgacgagaattgcaaaaatgtatttttatacattttccgtctattcatgtgtgtaaaaaaatgttttaaaaaacatgcatttttctacatttttcgacatttttcgacatttttcgtcggccgatctagaataatgtcgaaaaatgtaaaaaaaaaatgtagaaaaatgtagacaaatatagaaaatgcatgcgtttttttcaacatttttctacactcatgaatagggggaaaatgtataaaagtacatttttgcatttttagtcatcacatgaataacctcataaaacggatatgtgtcgatttacaaagcttgtgtactcctcgagaagagaaatttcacagttttaggcttatgaaagccgtgaattttaaataaaaaaataattagcaaaaatagtccgaaatcgaggagtttagccgaaaaatgtgaaaaaaaaactgtgtgcgtctttaatgagtactgtaatttcaaatttttgtttctgcggttttttaagttttttaaataaaattttagatttaaaattgaacaaaaaattcggaatgggttactgtagcatttaaagccgcataccgtaaagcacctaatttttttttaattttcagtgggttactggggtttaaaggagcatgcgtactttaccctaattttttaaaattttcagtttgttactgtagtttttaaaggctcataccgtaaagtacctaattttttttaaattttcagtgggttactgtagtttttaaaggctcataccgtaaagtacctttttttttaaattttcagtggattactgtagtttttaaaggcgcataccgtacttaaacctaatttttctacattttcagtggatacgagcatgtgtatgtgcttgactgtgatattggacaaagtgagttcacaccatgtggatgcctttcactgaccaaagtaacttctccgattcttggaaaaccccatggacatcagcgagcatcatttgagaattcatttttctatggggatattacagttcgtgatattaacctttatatggtgggttttcagcttttgccggtttgccggtttgccgatttgccggaaagttttattttcggcaatatggtggtttgccgatttgccagaaattttcattttcggcaaattggtgatttgctggaaatttcaattccggcaattttccgaattgccggaaattctgatttgccggaatggttgatttccggcaattttccggaaattttgattttcggcaaattgccgatttgccggaatgtttgatttatgacaatttgtcggaaattttgactttcggcaatttgctaatttgtttttttcaggacattttcgaacggctcttcaacaaattcaaagtaatcagtgagcctggctctgtgtgcattatcaattcaatgggatgggtaacagatgaaggagcagaaattctcgatggaattacacgtgtcacagatccagaattattcgttgaaattttcagagatcaaactgaagctcgat