Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K09H9.4   

sjj_K09H9.4RNAiJA:K09H9.4
PCR_productsjj_K09H9.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK09H9.4 Source_evidenceePCR749WS150 Sequence/Annotation Release
Overlaps_Gene (6)
Overlaps_transcriptK09H9.4 Source_evidenceePCR749WS150 Sequence/Annotation Release
WB_DNA_textsjj_K09H9.41132gatcaagacgtggaagggaagaggacaaattaagaataatatcagatcagtgttgtttcatagtagaaagcgttctgttaacaaaaaagtgtctcctaagtttagtttttcctgtgcgccacacatatttctttttagaacgagtgtgggtctcttgttgctcaaaaaactcagatgtttttaagtctactttaccagtattcattctgattacttggattctgtcaattattttacgtctcgtgcttaaggtttgaaggttgaatagttcgttacgttccatggatgttttgtaatctttatctgttggattaatatacctttttttgattctactataaaggcgcctagtgaacgcgttttgcacagactctattgctttctcatccgattttttcgtcggagaagacactactgttccatattctagacgaggacgaatgaaagttttgtataaaagaatcattagttttttattggaggtactgtactggttaaaaatgttggccagctgaaatttcgccagattgatagatttcttccaatgctccgagaaatccagtttttctgatattagaaatccaaggtctctggtaattgtttttcgctctatagggtaaccgtcaaggtggtatttaaaatcttttctacatctccctactgtgacgtgaactgtcttagattggcttagggtgagttttgctccccttgtccaatctactacagcgtctagagcagcctgtaagttgttttctgtttccgccttaggggtcgatacatacaatttcgtgtcatctgcaaactgcttacatgctactttttcgggtaatattgaagatatatcattaacgtagataccgaacaaaagtggtttgaagaatgactgaaaatttcacaaaatttgacgcttagattgaaataattaaaaatgcattgtgacgtcacgaaaattcatttttcccgccattgttaggtgtagtgaagcgatgggacaacctgacaaaacgcgcagaaaatggttttcattacgtggtcgtgaattttagaaaaaactcggccaacctttctcaaaaatcaccataatgagacattgtttcaaaaacatgaaaaatcaacgtaatggccgagtttt