Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K10C3.1   

sjj_K10C3.1RNAiJA:K10C3.1
PCR_productsjj_K10C3.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY67A6A.2 Source_evidenceePCR946WS150 Sequence/Annotation Release
Overlaps_Gene Y67A6A.2 Source_evidenceePCR946WS150 Sequence/Annotation Release
Chunk_score Abs_score904
Max_abs_score904Y67A6A.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI98434839844487
Overlaps_transcriptY67A6A.2 Source_evidenceePCR946WS150 Sequence/Annotation Release
WB_DNA_textsjj_K10C3.11005aatgaatccacgagctgtccagtcggaacgagtcgaacgagaacaaaatggatcgccaaatcaaattgaagaggacgattataaagacttgtcgtctccggatacatgttctgttgaaattcaaacagatgtagatgaacaaaaaccatcgtcaaacaactccgcgcctttgccaagtatggagctggaaatggcaaaactttctgagcagatagttgaaatgcatagagcagtttgttcttatgtagatccagtgacaaaacgggaaaattttgatatgaaaatggagactgaaacaacgaaaatcgcatttatgaatgcattctataatcctgaaatgattggtccaagaactcctttggatattactggaagacgggttgcaactgtaaaagatgtaatggatgaatggaaaaggaattttgtacttttctctgattggttaagagctcttcctgagtacaatcaaatgtcaattgaagatcaaattgttcttgccaaaaatcgatacgggacatttcactggtggatgtgtgcaaattggactgtacaagcaggatgtgagggagtatgttactcgaatggagcatatttcccaaaacaaccagaagctcaatgtattcctgatgttaaaggatcaagtggacgaatgtatgactcattgagtattccaattaaagaattgaatcttgatgaaactgaaattgttctaatgttggcagttatcattttcagtgatggtaagtggagcatgatgcttggtagattagaaatatttgaattttctatttcagagattacagaacttgctgatttgacaccagctggaaaagaacatgttcgaatggttggaaaccgattcgttcgcatgcttcatcatcatgtgaactcaaaagaatatggagaggcgatggaaaatggagatgatacacaaaatagtagtgaaagtcaagcagcagttcgaattgccaaaatgatgattcttctctcggcgactacggtaag