Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K10C3.4   

sjj_K10C3.4RNAiJA:K10C3.4
PCR_productsjj_K10C3.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK10C3.4 Source_evidenceePCR788WS150 Sequence/Annotation Release
Overlaps_Gene K10C3.4 Source_evidenceePCR788WS150 Sequence/Annotation Release
Chunk_score Abs_score716
Max_abs_score716K10C3.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI98605809861509
Overlaps_transcriptK10C3.4 Source_evidenceePCR788WS150 Sequence/Annotation Release
WB_DNA_textsjj_K10C3.4930aagactttcccgagccaaatcaaaggtaaaatatcattataaggatttttcttattcattttttgtttttcagatactggttccattcgaaactccaccaaatcgatattctcgtaatgcagcagcaatcaacaatatcgatgatattgagacaatggagcaattgaatggtcttctagaagaacttttggatagaaatcaatggctgtttgaggcacgtggaatcatgcaacacgttgtagctgtactcacgatcagcaagagtgttacaacgaaattgtctgtaattcaacttccaacatctccatcaccattccacgatgcaattaatatggcgatgcgtaacatttacccacgattcgatgatcttgtggaaagtcttgctgctcaaccaattgatatgcgtctgttggaagcacgagctctatcattgggtactgtatgctggtcactatacttgccgtatacacttttggatgcaaaatataaggaattgatgcagaagccattgaatgaaatgaatcttcatctagtaacaatcagaactgcagcacatcttgtttctatggcagaaaaaggtgcagaagatgtgagtattcaatgaactagaaattttaattaatgaattttacagaagcttaatatcgtcgatttgaaagatcatttgatgcgaatgcgacgtcaaatccggggagatatgttgcttgatgatgattatgagacagaagatgacttggatgatgtagaagaagttgatgacgaggcacatgatccagatggacttgttgtcaaaaataaaatcggaaaagatcatgaaaagatcccgttggtcgagtcagaagcaataattgatatgatcgagttgaccagaggtgtgtgatattaaatatgtatttcattcaacaatatttcttatttcagtccccgtcg