Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K10C3.6   

sjj_K10C3.6 RNAi (5)
PCR_productsjj_K10C3.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS K10C3.6a Source_evidenceePCR926WS150 Sequence/Annotation Release
K10C3.6d Source_evidenceePCR926WS150 Sequence/Annotation Release
Overlaps_Gene K10C3.6 Source_evidenceePCR926WS150 Sequence/Annotation Release
Chunk_score Abs_score863
Max_abs_score863K10C3.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI98727139873735
Overlaps_transcript (6)
WB_DNA_textsjj_K10C3.61023accaacatctggagccagtctcaacgggactccattcaaaaaagacagaagccccggatacgagaacggaaacagcaacggtgtcggatcaaacggtatgggacaagagaatatgcgaacagttccacaatccagcagtgtcattgatgctttaatggagatggaggctcgtgtcaatcaagagatgtgtaatcgataccgaagatcgcaaatctttgcaaacggcagtggggggtcgaatggaaatgacacagatattcaacaaggaagtgattctggagcatcggcatttgcaccaccaaaccggccatgcacaaccgaggtagtgagttggatggtacgtaaattaagaggtcacattgttttattttcaggatctgaatgaaatctccaggacaacacttttattgatggttgaatgggcaaaaacaattaatccattcatggatctttcgatggaagataagatcattctactgaaaaactatgcaccacaacatctcattttgatgccagcatttcgaagtcccgatacaactcgagtttgtctcttcaacaatacttatatgacacgtgacaataacactgacctcaatggatttgctgcattcaaaacaagcaatataacacccagagttcttgatgaaattgtctggccaatgcgacaacttcagatgagagaacaagaatttgtatgtttgaaagcacttgcattcttgcacccagaagccaaaggactctcgaatagctcacagattatgattcgtgatgctagaaatcgtgttttgaaagctctttatgcattcattctcgatcagatgccagatgacgcacccacaagatatggaaatattttgttgttggcaccggctctcaaggctctgactcagctgctcattgagaatatgacacttacaaagttcttcggattggcagaggtatgaaagcttttcttgtttgaatccgtacataaatgatagcttcaggtggattctctgctctccgagttcattctcgacgaca