Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K10D3.1   

sjj_K10D3.1RNAiJA:K10D3.1
PCR_productsjj_K10D3.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK10D3.1 Source_evidenceePCR847WS150 Sequence/Annotation Release
Overlaps_Gene K10D3.1 Source_evidenceePCR847WS150 Sequence/Annotation Release
Chunk_score Abs_score742
Max_abs_score742K10D3.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI71178827119027
Overlaps_transcriptK10D3.1 Source_evidenceePCR847WS150 Sequence/Annotation Release
WB_DNA_textsjj_K10D3.11146cccacaccggagaaattttaataattttaattgttaagcgattcctgcaaatttaatcgatgaggtgaatcccgtcttggagtttgttgactttagagttcaagtgattccgtatgaaacaaaaccattgtggaggatcaagcaagaaagttttaaaattgttggtatttcaatagaaaatggattattttcagtatgtaattgtctaattctcggagcatcagctattatacttcccgaacagtatgatggacacctggcagctgcagcgattgttcaggtactgaaattaatttgaaatattttgtatgaaatgtgtgaattcaataccgtatttgttcccaatatgattagataaataccaaaatgaatttaatttgtacgattttttaaacaaacatacacatttagagtatcgctgataatacaaatgtaccatgtgtgagtcttcacctgtcaccccctactcgtccatcaactcatcttcatccacatttaaatgcaaaatccctggcggttgctgcatttataaaacgagagaaatggaaagatgttgtagttgtgttcgaagaaccagatgaacttttggaaattactgatatgataacagctggacattttgatcccgactcattttcatctcaattggttcgactaaagcatggtgatgattatggcaatgagttgaagcatatcaaaaataaattaggttactactaaattcaaatttgtttgaaaatttagtaagctcagatcgttatcgaattgttataaatatccctcttcaaaaagctcttcactttttggagcaagcagccaatatgtcaatgtgtggggtactgtatcattatgttgtcatggatatggttcgtttatttaatgcctacaaacttttgcataaatttcaggatttggtgactgtggacattgatagtattcgtggaattgaggattgtaatattacctcatttggtgtgcatgatgtcaattcagaatatattgaagatattagacaagaaattgttcacaaatcttcaattagactaccaaagaaaggtgttcctgtgagtaactttttgaattgttttaattaaagtcaattttgcagtatacaacttcaatttggattgacacgctccgactctt