Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K10D3.2   

sjj_K10D3.2 RNAi JA:K10D3.2
Simmer:K10D3.2:Screen_A
Simmer:K10D3.2:Screen_B
PCR_productsjj_K10D3.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK10D3.2 Source_evidenceePCR747WS150 Sequence/Annotation Release
Overlaps_Gene K10D3.2 Source_evidenceePCR1033WS150 Sequence/Annotation Release
Chunk_score Abs_score1012
Max_abs_score1012K10D3.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI71263927128566
Overlaps_transcriptK10D3.2 Source_evidenceePCR1033WS150 Sequence/Annotation Release
WB_DNA_textsjj_K10D3.22175tctgcacaatagggaaaacttgttcaatttatctcatggttaagtttatttttcaatgctaaaaacaagaacttacttgaaagaagagcggaaaatcattggttgaagtaatcgacggtagtggctcacatttctgcattttaataatagcatcacggaacgaagcggtgaatgactcgcagagagatggcatctaaaaattaatttatttaattataaagtttgaatgcatgttctaatttctcatggttacactactactaaaagacattatctagacatgcgtccgtatatgaaacattaaaaaatagaaacgaacgcagtcaatcgatcaaatgaatgggtatgataagtgcggcgcgacgactacagcggcgacgttgacacaaaaaagaaaccgataacaattttggttgtcgcggattggattatgtaagattgatgtttatttcttgcttcttcatttgcatcccgacgggatactttctgttttttcttttaaaaattatattctgttaggatcattatctcaaaaataacatcgacctacaaaattgtttttaaatgggaaggaatgtgatgaccaaccgatgatactatctaagtatttgcaaatttagactttagaatttagtttttgaaaaaaatgtgttgactagaaaataaactagcaataaatacttgtagtcattaacacaatgtttttatttgtcagttgacagctattcccaagatacataggttttgtatattctgtcagacagtatttttatttatcagtcttgtcagtattgaaccactttaacagtttatatcccgacggccagatataaactgttaaagtaaaccgaaaaagagcaagattagtaggagaaatacggtgaatgttgatgaaattcaaatgtatcaaaataaattctttaaattatttttttgaaaaaattgtttattttctttactgcggaaaaaagtgaagatgatttattttttggaaaaacttaaaacgttgcatcgaaagaaaaaagaacgctccgaccacctcgatctttgccgcagaacacaatacagacaaaatttatcacccgtctcttatcacttacgaaaaaaaaactgacctcatgatgcattgccaggaagtctaatttcggaggcttttcattatcagacgatgtgattgccattgaagttggtgctgttacattcttttccagaatatccgcaaatgttcgtttctgattttgtcctccagatgagcatcgtctcgctgaatctcttctccaacgatctttacgaattatttcttcatttgcctcgcgaatttcattatcatttacatcgacgaatcgagtagcatctccggaaacaaagttggcaatcagtgaatttggacgatttggtgatcgagcactatcacttctttttacattccaaacatctggagcactggcagtacgttcatccaatggttcagatgtccgaatccgaccccaagttgtcagattatcatttatacctgattgccaatgtccagagtctgcgaatgctaattgaaaatcttcttttttcatttgacatctctctcgaaactgttgagagtctaaagaatcagttgatacagaaggatcaactgattcaaagagcatcgaatcttctccacaaaagttgagagcagcgattcgagcatcaatgtcatcgggccattgatcctcttcaggcatcatgtgcagttcgcacagttccaccattttggtggaagaattgagggatgaagccctttgtagacgttcagaataacagaagctgactagaaaaagaagaaataaagggacgcgtctcgcgccgccgcgtcgccgtcgttgtcgatcaatgaatctgcgtccctggccttttgaaaaatgagagaacgagagaaaacgagagaagcgtcagctggctatgcaatccaaattgtatctctccgtctcactcttcaatatactcttctcgttgtgtttcgcaacggagagatgttgtctgtgtctctgtgtagcgctgaaatgagagaaacactcttgagagttgtatgcaaagaatagaagacagacgaacgagagtagtttgagggaaagtgttagacgagatggccgagaaaatgtacttgtgcatgaaagatgattggctcacatttttcaagac