Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K10D3.5   

sjj_K10D3.5 RNAi (7)
PCR_productsjj_K10D3.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH37N21.1 Source_evidenceePCR842WS150 Sequence/Annotation Release
Overlaps_Gene H37N21.1 Source_evidenceePCR842WS150 Sequence/Annotation Release
Chunk_score Abs_score758
Max_abs_score758H37N21.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI71415177143160
Overlaps_transcriptH37N21.1 Source_evidenceePCR842WS150 Sequence/Annotation Release
WB_DNA_textsjj_K10D3.51644cgaatcatcaaatttcgggtcttatttaaaattctatcaggaaagggtgaactgattcaggaagtatactttgaaagaaaagaaacgtactcattttcaatatgcacattgatctccaaaatgtgtctattttctaaccgcatatctctctccccatttggttctccttcttcttccggagtcggtgatccagcatcacgcccatttgatgatcctattgtaacatttgctccattgacttcaacttcgactttactcgttgattccgtactcgtaacttcaccgattttcttatcaactgcttcaggacttgctgatttaccgatggaagatggtccatttgtattagttgttgtaccacttggctgtgatgattgaccaggtaaactagtattaactgatgtttctgcagtgattgttgagttggctgaaggatgcgttgatgaaggagcagatatatccgtagtgatcaaagtcgatggattagtctgaaaactctataattttcatagatttacacaagttctttctgtatctcatacattcgaatatgcccgtaatgttgtagatggttgatgtgcaagtggtgcaaatgcagttaatggataaattccatttcgaacatcatcgagaaatttttctagatcaacttgaaatgcggccacttggcaataagccatctctcttaatttcgacgttgcagcaatctgaaaaacaatgtagtttaaattaatgtacttagttcactgtattcgatcaaaaggtagtgtagataaccgagaagcgccgacaaagtgaccgacgaatcaaatatttacttttgtggaggggggaaagagtaacaacaaaacgaactcctcatatggccatttacccgataacttttagaacgcattagtctatgtggggattcaacttactgtttcattgtcttttattcggaatgcactttccgaaacatcttcatactttttcgagtcgacaattgcgtgcgcagagagcaattttaatgagtgaacctgaaattttggtaattatgcttcagaaaaaaatgtcattgaaatttgtatttgaaattttttgactcgcgaagtatacaactaccacacttggaattttttaaaggttttttttttggcagaataccaaatttttaaaaaaaattgagtttttgagaaatgaatagaaattttatatgttagagtacacatcggctttagataaaattaattttaacataattagaatctaaaaattttgtaaagaattgtttttggtcgttatggcaaaaccttttaaaaatatagtcaatttttttactgtaaataataaatttcaaataaaagttttactcttgcatttagtaatttcagatccatagaaaaatagtttcaaaccattttttcacagacggtacttcacatttttgctttttttttggcaaatcttatggcatccacgtacctcaaaaagtatctgatgaaataaaagttctcttgctgaaggccgttcagctggatcttttctgaggcattgtcgtataaaatcttgttgcatcggatcttccaacgatcgaatcgctttttcaatgacatcttcggtgactggtccttctgaacttccattctgacatcccgaaagtcc