Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K11D2.2   

sjj_K11D2.2RNAiJA:K11D2.2
PCR_productsjj_K11D2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK11D2.2 Source_evidenceePCR786WS150 Sequence/Annotation Release
Overlaps_Gene K11D2.2 Source_evidenceePCR786WS150 Sequence/Annotation Release
Chunk_score Abs_score745
Max_abs_score745K11D2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1250612912507215
Overlaps_transcriptK11D2.2 Source_evidenceePCR786WS150 Sequence/Annotation Release
WB_DNA_textsjj_K11D2.21087cagatcgctacagccaacaaggaacacatcgccgacctgatcggtgtgctgatcaatctgatcactccatggttcccaaatgccatcgactttgttgatgacgtgttcggtgatttggcgccaaagctcgctcagccatatcgtgacgagatcttcagtattgccaatgccaccggtatcccattgggacagatcaccatgtataacatcttctacgagatcttcaccgtttgcacatcggtcatcgctcaggacaaggacggccacgttttccacgccagaaacctcgatttcggactcttcatgggatgggacccagttcttcacgactggcaaatctcgcaaaagcttcgtaagatgatcatcaacgtcaactggctcaaggacggaaagctgttgtacaagtcgaacaactttgccggatacattggaatctacaacggtctcaagccaaacgccttctccttgactgctgacgatcgattccagcttgtcggaggatactacggtattctcaagtgggtgttcggattggaggccgacggaaaatggatgtcctggttggcaagagagaccctcgagactaagaccagtgagttgaattgttttcttgatgacttagatccttagaattcggaagctttgatttccaggaagcttaggcttagattcaagtgtccctaatctttgcttctaatatccattgggctagatccgtctgagatccataaaggctctatatcccgagctttcagcctacctcgacgccaaggagcacttgatgaacactccaatgctctcaccagtctacttcattctcggaggatccaagaaggacgagggatgcatcatcgctagaagtctcgacaagaccgcacttctcaccgagatggccacatccccacacggatggtacctgttggagaccaactacgatcagggaaccgaggtgagagatgctagagttgaaggtgtagagtaggttctggtagacggatctaggggcccaacttttaggagaggtccttctctaggcctaggtctagtattttgaacccagcttctttttttgagtgggtcgaactcc