Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K11H12.2   

sjj_K11H12.2 RNAi JA:K11H12.2
Simmer:K11H12.2
PCR_productsjj_K11H12.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K11H12.2 Source_evidenceePCR681WS150 Sequence/Annotation Release
Chunk_score Abs_score618
Max_abs_score618K11H12.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV653483654663
Overlaps_transcript K11H12.2.4 Source_evidenceePCR651WS150 Sequence/Annotation Release
K11H12.2.2 Source_evidenceePCR677WS150 Sequence/Annotation Release
K11H12.2.1 Source_evidenceePCR681WS150 Sequence/Annotation Release
K11H12.2.3 Source_evidenceePCR677WS150 Sequence/Annotation Release
WB_DNA_textsjj_K11H12.21181gataacaaccatttcattttcggaacaagcccaaaacaaaataaaataacaagatttatcgcttgcggtggaaaactttggtgttctttctcttccagttcttggcttgggatcctccgcgggtagcagagaaacgccatccctttccgagtccacgagacttgcgtccagcagaggtgagtcctctttgctcacggtgcttgtgaactggcttggtgatccattgggtgtctgggttacgacggatagccttgtggaatggatcgatcaggacaacctcgtagaacttgtaggtggagtcctcagcaacccagtaggagttgagaacacggagggatccaagacgacgtccagcgcggccctgaaatacaacgaattaactttgaaaagtaaatgctaatatctgaaaattttgtttaaattgtcacaatgtcatgaatccaatacaccacaaggtgttcggggattacacaatgtttttctatagccatcagtggattaagtcagtactattaaaaacagtctgctttgcccagacactgaggcaacaatttcatctaatcatttaattcgtagtaatcacctcagcaacggcttgcttagacttggcgttcttgagctcgttaactccatgggtctttggctttccgtaggtttgtcccttgcagactggacgctttctgtttcctctgcggacacggacgcggtagacaacgaatcctgaaaaatgaaatttaatctcaataaattgtatcaatgatatgaaactggaaagttctatataactcaacagggattactcaatgaattttatatagccatcaatggattaggttgctcaagcgggtgcagggcaccttgcccagacattgtggcaagtagcttttaaaattttattcaaatctttacaatcttaccttgcttggcacggtatccgagacggcgagccttctctggtctggttgggcgtgggacacggtggacggcgctcaactgtctgtagtgccaggtacgaatacggagcaagtagcgaagagcatctgactgcttcttgcgccagatttcctgcatatacttgtatgcacccatgttttctgaaagaaaaaaggttagaataacgagattgaggggttgaataaataaaattgttgaaaaagaaaagtgaatcgaagaatggaaca