Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K12D12.1   

sjj_K12D12.1 RNAi Simmer:K12D12.1
PF:GL1_6A9
PCR_productsjj_K12D12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK12D12.1 Source_evidenceePCR1027WS150 Sequence/Annotation Release
Overlaps_Gene K12D12.1 Source_evidenceePCR1027WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII1187787911878905
Y46H3C.4 Chunk_score (3)
ZK1127.7 Chunk_score (3)
K08E5.1 Chunk_score (3)
Overlaps_transcriptK12D12.1 Source_evidenceePCR1027WS150 Sequence/Annotation Release
WB_DNA_textsjj_K12D12.11027gcgtgaagtcaaagtagctcaattggctggagctgtcgctgaaatttctgcttaccatcacggagaacagtcgcttatgggaacaattgtgaatctcgctcaagattacgttggctccaacaacatcaacctgcttcttccaatcggacagtttggtactcgtctccaaggtggaaaggacagtgcttcagctcgttacatcttcactcaactgtcgccagtcactcgtacactcttcccggctcacgatgacaatgtccttcgtttcctttatgaagaaaatcagcgtattgagccagaatggtattgcccgattattccaatggtactcgtcaatggagctcaaggcatcggtactggatggtccacgaacattcctaattacaatccacgtgaactggtcaagaacatcaagcgtcttatcgccggcgagccacagaaagccttagctccatggtacaagaacttccgcggaaagatcattcaaatcgacccgagtcgatttgcatgctatggtgaagttgctgtgctggatgacaacaccattgagatcaccgagttgccaatcaaacagtggactcaagactacaaagagaaggttttggaaggattgatggagagctcggacaagaaatcgcctgttatcgtcgactacaaagagtatcacacagatacaactgtcaagttcgtcgtgaagctctcgccgggaaaacttcgtgaattggagcgcggtcaggatcttcatcaagtcttcaagctccaagctgtcatcaacactacgtgcatggtacttttcgatgctgccggatgtcttcgtacatacacttcgccagaagcgattactcaagagttctacgatagtcgccaagagaagtacgtacagagaaaggagtaccttctcggagttcttcaggctcagagcaagcgtctcactaaccaggctcgtttcatcctcgccaagatcaacaacgagattgttctcgagaacaagaagaaggcggcgattgtcgatgttttgatcaagatg