Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K12D12.1   

sjj_K12D12.1 RNAi (2)
PCR_productsjj_K12D12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK12D12.1 Source_evidenceePCR1027WS150 Sequence/Annotation Release
Overlaps_Gene K12D12.1 Source_evidenceePCR1027WS150 Sequence/Annotation Release
Chunk_score Abs_score1006
Max_abs_score1006K12D12.1
Specificity_index0.49
Rel_score1
Map_statusUnique_ePCRII1187787911878905
Y46H3C.4 Chunk_score Abs_score168
Specificity_index0.082
Rel_score0.167
ZK1127.7 Chunk_score Abs_score587
Specificity_index0.286
Rel_score0.583
K08E5.1 Chunk_score Abs_score291
Specificity_index0.142
Rel_score0.289
Overlaps_transcriptK12D12.1 Source_evidenceePCR1027WS150 Sequence/Annotation Release
WB_DNA_textsjj_K12D12.11027gcgtgaagtcaaagtagctcaattggctggagctgtcgctgaaatttctgcttaccatcacggagaacagtcgcttatgggaacaattgtgaatctcgctcaagattacgttggctccaacaacatcaacctgcttcttccaatcggacagtttggtactcgtctccaaggtggaaaggacagtgcttcagctcgttacatcttcactcaactgtcgccagtcactcgtacactcttcccggctcacgatgacaatgtccttcgtttcctttatgaagaaaatcagcgtattgagccagaatggtattgcccgattattccaatggtactcgtcaatggagctcaaggcatcggtactggatggtccacgaacattcctaattacaatccacgtgaactggtcaagaacatcaagcgtcttatcgccggcgagccacagaaagccttagctccatggtacaagaacttccgcggaaagatcattcaaatcgacccgagtcgatttgcatgctatggtgaagttgctgtgctggatgacaacaccattgagatcaccgagttgccaatcaaacagtggactcaagactacaaagagaaggttttggaaggattgatggagagctcggacaagaaatcgcctgttatcgtcgactacaaagagtatcacacagatacaactgtcaagttcgtcgtgaagctctcgccgggaaaacttcgtgaattggagcgcggtcaggatcttcatcaagtcttcaagctccaagctgtcatcaacactacgtgcatggtacttttcgatgctgccggatgtcttcgtacatacacttcgccagaagcgattactcaagagttctacgatagtcgccaagagaagtacgtacagagaaaggagtaccttctcggagttcttcaggctcagagcaagcgtctcactaaccaggctcgtttcatcctcgccaagatcaacaacgagattgttctcgagaacaagaagaaggcggcgattgtcgatgttttgatcaagatg