Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K12H4.4   

sjj_K12H4.4 RNAi JA:K12H4.4
Simmer:K12H4.4
PCR_productsjj_K12H4.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K12H4.4 Source_evidenceePCR528WS150 Sequence/Annotation Release
Chunk_score Abs_score444
Max_abs_score444K12H4.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII80448538045664
K12H4.5 Source_evidenceePCR6WS150 Sequence/Annotation Release
Overlaps_transcript K12H4.5.2 Source_evidenceePCR6WS150 Sequence/Annotation Release
K12H4.4.1 Source_evidenceePCR528WS150 Sequence/Annotation Release
K12H4.4.2 Source_evidenceePCR519WS150 Sequence/Annotation Release
WB_DNA_textsjj_K12H4.4812tctactgaagtgtttcagccacaacaattatattttctatatgtatttatattaattttatttttcatttttatccaaagtttcaggctgattcgagctcaaagatgcacaatcttctgtctcgtgctaacgcactcctagcgttcactctttgggtgatggccgcagtcacagcagcttgtttcctgtcaacagttttcctcgactacactgttccaaccaagctcactgtcaacgatgtcaaagtgtaggttttataagagaaataaaaaaattgcgaaattctttcaagcgtttctccgaaaacattttaaacgtatttctgtaaatcttattccattttcaggagaaacgttgtcgactacgccacggatgagcaacaagccgatctcgccacactaaacttcaatctgaaagtcgatttttcaaagattttcaactggaacgtcaagcaattgtttgtttatttggttgcagaatataaatcgaaagtcaacgtaagctttggaaacttttattgaggatcgaaaaaaacttctttttttttgcaattgtaggaggttaaccaagtggtgctatgggacagaattgtggaacgtgctgaccgtgtggttatggacgagatcggtgtcaagtcaaagtattatttcctcgacgatggaaccaatttgcttaaccacaaaaatgtcacctttgttttgaggtttgaattgaaaattcgataaataaaaccaaatattaaaatatttagatacaacgtgattccaaactctggctatcttcgtcttgttcaatcttccgatcaagttgtt