Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M01A10.1   

sjj_M01A10.1RNAiJA:M01A10.1
PCR_productsjj_M01A10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM01A10.1 Source_evidenceePCR1056WS150 Sequence/Annotation Release
Overlaps_Gene M01A10.1 Source_evidenceePCR1056WS150 Sequence/Annotation Release
Chunk_score Abs_score993
Max_abs_score993M01A10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI55644105565593
Overlaps_transcriptM01A10.1 Source_evidenceePCR1056WS150 Sequence/Annotation Release
WB_DNA_textsjj_M01A10.11184taattggtcgcaacggtgtagagattcaagcaatctctcaaaaatcaggatgtcgagtgcagattgtcgccgaaccatcaacaactgggtatcggtcggtcgatatttatggaatttcggagaacattgaagttgctaagaaattaattaatgaagttgtggcgcgtggacgcaagttatcacaagagccattgccttgctctgttccacaatttcaaccaataccggcagtttcaaattcgtcaaaagtgactatcattataccgattcctgcaaataagtgtggcgcaatcattggtaaaaaaggcgagcagatgcgaaagctacgggtaagtagtgaaacaaaacgtttaatgaagttagaaaattactttcagtcttggaccaattgcgactttatcttgatacaagaaaataacatcgccgactcagtgaaaccgcttcaaattactggacaaccaaaagaagtagagcacgcaaaagctcttgttgccgatattcttgatggtttcgatgaatgtcctccagctggaatggctggaaacagtcccgtagcagccatgtctcttcaggttaaagtaccacgttcaactgttggagcaattatgggacttcaaggaagtaatattaaaaagatttcaaatgagacagaaactaaaattcagtttatgcccgatgatgatccaaagttaatggagagaactttggtagttattggaaacaagaataaggtttacgtgtgtgctagactactccaaaaaattgtggaagcgaattctgagaatgcgaacactccaatttctgtgagtttttctatttattttttaaagtatcagtcttaaaagattaaatttcaaaattaatttttagttgttctacatgttaattccggcttccaaatgtggtttggttattggtcgtggaggagaaacaatcagacaaattaataaagaaagtggagcctattgtgagatgtctcgtgatccaagtatttctgccattgaaaaacaattcgtgattcgaggatcagaaacacaggttgagcatgcaaaacatttgatccgagtgaaggtaggagatataccaccgaatactccgtatatcaacactcgagctgctcagccactgcaatttagtcatcaaaatcccacagcaattgactcatggcgtggtaagcatcatta