Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M01A10.3   

sjj_M01A10.3 RNAi JA:M01A10.3
Simmer:M01A10.3:Screen_A
Simmer:M01A10.3:Screen_B
PCR_productsjj_M01A10.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS M01A10.2a Source_evidenceePCR9WS150 Sequence/Annotation Release
M01A10.2c Source_evidenceePCR9WS150 Sequence/Annotation Release
M01A10.3 Source_evidenceePCR801WS150 Sequence/Annotation Release
Overlaps_Gene M01A10.2 Source_evidenceePCR9WS150 Sequence/Annotation Release
M01A10.3 Source_evidenceePCR950WS150 Sequence/Annotation Release
Chunk_score Abs_score866
Max_abs_score866M01A10.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI55491205550251
Overlaps_transcript (3)
WB_DNA_textsjj_M01A10.31132agtgcgcgggtaagaatagaaagaaccattagagtttataatttaaatttatatcacattttacacgagacaacagagaacagatctagaaaggggatggagagaaaggcccagcaaaattattaataaattaaagtttaacaagttttttggtaggagggaaccgatggtattgaaagtttaaagctactctgatttttgtttgctttcggaaatagcacgaagaacgcgatttccggcaacaaaagtgaggaatccaagaacagcgaggtacttgagagttacgaacatatcgaattgaacccagaacatgaaatagatcccgaagattccaataagtccgacgtggaagattggaacccatggtgaagctggagcattttggaaatttattccaacttgggaccactgaaatttgagtccatcggtctttttcaatattagtagaaataacttaccaatacgacaagaatgagaagtggggaaaggcagataatggtgaacaaatcagaaatgagcgctgatggtctcttttctggttgacggaagatatgggagatttcgttcaatggctcaaagtgcacttgttgtgattttggggttggctcgtaggcaactgggagagccgcgtcgatgttagcctaaaatattaaataagaaaacattaaacatttgaaacaacttacaaattgccagttgattggattcttgatagttacgtctccaacgagaaggctgatcttgaactgtccactaaggttgcggaatgatttagcagcggtacgaagaacattatcgtaaacatagttgccattagcatctggattgactaccacaacaacatcttcaccattttgagcgacaaatcgaagaaaaacttgatgtggcttcactttggcgttgtcggatttcttggcaacggtgaacgagacgtagagacgctgagaagcatctgctttgagttcgtttggcagtttggagaagagtgcgacactagaaaatcatgcattaattatacataaatttagttgtaatctactcacgttttcaaattttcgtcacttggttgttggtccttggccaaaattcccactttgaagttgttaactgccacatcatcgactgcagcaag