Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M01A10.5   

sjj_M01A10.5RNAiJA:M01A10.5
PCR_productsjj_M01A10.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM01E11.4c Source_evidenceePCR825WS150 Sequence/Annotation Release
Overlaps_Gene M01E11.4 Source_evidenceePCR829WS150 Sequence/Annotation Release
Chunk_score Abs_score745
Max_abs_score745M01E11.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI55664915568083
Overlaps_transcriptM01E11.4c Source_evidenceePCR829WS150 Sequence/Annotation Release
WB_DNA_textsjj_M01A10.51593tacatcatccctgtctggcaacttctgcagccgaaacaggatccgaaagtgaggcgtcagaatcttccaatgcgcttcttagtttttcttcttggcgacgacggttttcaaggatttgctcaatttttctgtcgatcgaagaatcactgaaatttgttttatgtatatttcaaaaaagaattgatattccaaaatgcttactctattttaacttcatttccacttgcatcaaaataatgagcaattccatctgtaacaatacgttcgtatgaatttcctttcttatccctgattacagttggtggatggtatttgatgaatcgaacgtgtggtttttctctgtgaaaaaagaatttatttcagattttcgatttaattcagtttggtactttttcaaaaaataattccaaaaaattaaactaactgggactgtccactgacttcgacggtttcagaatcatctcctcctggaattttgatttgtttgatttcctcattaacaggcgctccaggattcactgaataatatgtttctccattttcagaatttcttgaattttcgctttcagatagatcttttggttcttgtctatcttgtttctcataaaaaacgctatcattctcggaatttccgtcttcactattggtgttcaaattgtttctagtttgcaatacatatgctggcacttcgttacgttcctggttgtcttgattgctattggatgcctggaagaaattgattttgttaattttgatcaaattttgattttgatacaggcacttcaggctggaaattatttcacttatgagaatggtccgacatatgtcgggttgctccatctccatcagaacacacggtgagtcgcgcgacccggtagatgtcggtccaagatggaaagtgagaccttcgtaacgtaaaaataacgtctcaagatgaagaaaagtttttcaattaagatttcgtagaaaaagagtgtgcgcctttaagaagtactgtagttcaaatctttggctttttgtgattctctttggatttttcattattttcgaaaaaggaacttaagatgtggccgcatatgtggaaaatttgaaataatgaacaaaattaagagctttttagaaacttttttgttctttttttcgaattcggctttggaactactgtaaactttaaaggcgcacactctttttcttagtcttcatttgaaaactttcgatcgatcgatcatgtccagaaccgtattctcgcgtcataagtctccatagtttgcactcgagtagtaagatatcattaaaaaatttgcttccttttttaatcaattgtattcagtatatataattgtctacctgctgattccagttattctcgtatcctcttggaatgattccacgttgcctatattgatttctgagccattcatcataacctggatgactctgtggtggttgttgttgaatatcataatattgataattattcgaaatttgattattttgagaagttgattgatcaaatggaagttttcttccagatgaatcataagctggacgatgagaatcagtttgagatccagatggacgaccgtattgctt