Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M01A12.1   

sjj_M01A12.1RNAiJA:M01A12.1
PCR_productsjj_M01A12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS M01A12.1 Source_evidenceePCR172WS150 Sequence/Annotation Release
M01A12.3 Source_evidenceePCR357WS150 Sequence/Annotation Release
M01A12.4 Source_evidenceePCR559WS150 Sequence/Annotation Release
Overlaps_Gene M01A12.1 Source_evidenceePCR172WS150 Sequence/Annotation Release
Chunk_score Abs_score152
Specificity_index0.143
Rel_score0.306
Map_statusBottom50_percentile_ePCRI56434535645712
M01A12.3 Source_evidenceePCR357WS150 Sequence/Annotation Release
Chunk_score Abs_score294
Specificity_index0.276
Rel_score0.593
Map_statusTop50_percentile_ePCRI56434535645712
M01A12.4 Source_evidenceePCR559WS150 Sequence/Annotation Release
Chunk_score Abs_score496
Max_abs_score496M01A12.4
Specificity_index0.466
Rel_score1
Map_statusBest_ePCRI56434535645712
F42C5.5 Chunk_score Abs_score123
Specificity_index0.115
Rel_score0.248
Overlaps_transcript M01A12.4 Source_evidenceePCR559WS150 Sequence/Annotation Release
M01A12.1 Source_evidenceePCR172WS150 Sequence/Annotation Release
M01A12.3 Source_evidenceePCR357WS150 Sequence/Annotation Release
WB_DNA_textsjj_M01A12.12260acaaggcgtcactgtttatcaatgtgaattgaaatcgtataaagctccgaagaaactcaatcgccgaatgatttatataatttgctgcgacacatgtaatatttataattatcccaattttataaaacatatcaaatttttcagctgttggatccattcgttctcctcgtcaacaaacagttatcatggaatacatgtgggcttttgaagaggcaaatgcaattgaaaatggagtagcattggcagatgcaaaaacaactgttttggttcatgcaattgctggaactcgtcgatgtgcttcatttgttgctacatcagttatgtgcaaacagttacttgaagctggaaatttttcggcaatggaaacatggtttgaaatgagaaagagaagagctcatacatgtactcgtaaacatgatttcttttcgtcaatctacactttttttgcattttgtgttcaatgtagtgccgtcagcgagactgatgagaattatgtcaaatctatggaggtaagtgatttttatggaaaccatgttagtatattattcatttttcatattgcgaagacaatcctcgaaaaaaagaatcaagaacagaaaactgcctagaaatttgaacttgctttttttagcaacttatacaaccgaataaattttctttggcagatctttatagttttattgtcgcattccactcattctctgaaagaagcattaaagacagttattggttttgaactcaatctataatataatgtgcaaaaatctatgtaaaattgaagattaattcctctgattggaaatttaattggtattggtattattggtcaaatgttcacaaaactaagcagaaattgcttgccaaaatctcagtcaatggaattacgtagggaaccacacatgcagtgaagatccatcgactcaattttattacgtttccgtcggaagctattcgaaagttgttcgtagtctatggtttctattgtatatggtggttcaatattcgtccaattaaaccgtcttctctcattcagggtgctttctcataattatcgaacctcgtcaacctataagactagtttgtgtcaagtgcaattgtcaacttggattgaagaaagattcatttctcttttttacacgttgattttgaagtatttcaaaaatttctgacatttcaagtatctgccactgaccatgaaagttagcctttacatttgtagaattactgattcagtaaacatttcagctgtatttttatatagttgtctcgcaatttgtaggtatcagaatgtcgtatatttggcgtcaattaggatctcctacggttgcaatcacattatcagttagtacagtaatctatgttactgtaatttgtccaattgttttcatccacttgtttggggaccatttgaatgtcttagaggatgatgaatgtccggtttgtttagtttaatgtttaattcaatatttcaatattttcagattcaaatgagtgaccttcggcaacgagtgagttttgttagagagcaaattcacgaaaataccaggaagaaaagagaattggcgtgtaagttttgatagtccagttttttatttgtagtattttgaaatgggccttgcaagtataatagataattaaaatagttgagcttcgttaaataatttgatcaagaaaatatgtcaggatttgtattgcacttgtatgggattcatattaaaatttttggaaaatattaattcgtttccgaaattaaaaaatatttccaaaataattttagcatgctgcattggaccacctggaatgaaaggatttccaggaaagaattcaagagatggatatgacggagaaccaggtgagataaacaagggaaatattattaattctcatatcaaaaattaaggtcgagatggccaacctggacgtccagcagatggtgatagtcgaatggtatgtatacgtgaatgcccaacaggacgacctggacgtgaaggtggagatggaccaaaaggatcaaaaggacaaagaggacgtactggtcagcaaggagattcagcgccaccgtcaatacgtggtgaacctggagaaagaggagataagggattccctggagttgcaggtatgcttcttaagtagtaaccactgacttttcttcattttgttgatttctttaaagatcttgagtagtgctaaattgttctaaactaaggaacgtaatagaatagcttttcaaaaattgtttgaaacttgccaattaacaggt