Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M01B12.4   

sjj_M01B12.4RNAiJA:M01B12.4
PCR_productsjj_M01B12.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS M01B12.4b Source_evidenceePCR711WS150 Sequence/Annotation Release
M01B12.4c Source_evidenceePCR711WS150 Sequence/Annotation Release
Overlaps_Gene (5)
Overlaps_transcript M01B12.4c Source_evidenceePCR711WS150 Sequence/Annotation Release
M01B12.4a.1 Source_evidenceePCR711WS150 Sequence/Annotation Release
M01B12.4b Source_evidenceePCR711WS150 Sequence/Annotation Release
M01B12.4a.2 Source_evidenceePCR711WS150 Sequence/Annotation Release
WB_DNA_textsjj_M01B12.42278ttctgaaggctcttgaatctctggagcttctggagctacagtaacctcattatgatgctcttcaattacagtaggagtagcttctggagcaatttgttgctcttctgcaacaacagcttctggagctacagtaatctcttcctgctcaactacagcttctggagcttcttcgacaactgcctctcgagctggagctgctggttcctcgacagtgagcacctcttcctgaaccgctggaacttctggaatcgcttcaactggagccaccactaccaccggagcagttggctcctgagcagccactgggctcgcggactttcttgcagcttctggctttccaaacggaagttttcgtggcattggtggctttcgttgatccattgaacgacgattattcgagcttgatggtgttgcggctggaaaaaattacttttttccggaaattttaaaacttttagtattccatagttttttttaaacgaaaatatttaatatttcgagggtttttgagataatttgagctcaagagaccgaatttcataacgagaccaggggtgtgcggcaaatctcaaaatttgccaagctcggcaaattcggcaaatttgccgtgcctaataaactcggaaaaatttgatatttttaatgttttttggagcaccaaaactactgaattcttaacacacatctggtttctgaataagttccgtgtagtatgtctgtttaagcatcaaaatagctcaattttgtgtcattttactacatttttggctaaaaaatcaatagttttagtcaaaattgtactgtcaaatttttgacgtgtgcggcaaatttcgaaatttgccgagctcggcaaattcggcaaatctacttttttgaactttgccgtgctcggcaaattcggcaaatttgccgagctcggcaaacggcaaattcggcaaatttgccgcacacccctgaacgagacttttcaaaaaaatttcaaaattttttttatttgttttctccaagaaatcttttttttccataaaagtgctcataacgatatttaaatttaaatcaatttaaaaatagtttttctatgaaaaattgaatttgaaattttttaattcaaaatttttgaactaccacacaattcacattattacttgcttttttcaattttcttctatgaaaaattcagaaaatttgaagttcgagggatttcaattagttttccaagtcagacacaactaaatttcgtgaaaaaaatacaaatttcaacgagtttgaatattacgggaacacaaaattctaaaaatgcgtactgcacaacatatttgacgcgcaaaatatctcgtagcgaaaactacagtaatcctttaaatgactactgtagcgcctgtgtcgatttacgagaatcatttttaatcgataaaatattagaagaaaacacaaaaatggcaaaaaaacacgaaaaattgaattctttcgaaaatcgagtccccgtaaatcgacacagtagtcattaaattattgactactgtgtcgatttacggcgactcgattttcgaaacaattcaattttcttttcattttttgtattatcttgtcatttttgtgctttttctaatattttaccgattaaaactgattctcgtaaatcgacacaagctctacagtagtcatttaaagaatcactgtagtttttgacacgagatattttgcgcgtcaaatatgttgtgcagtccgcattctcaggatattatgttcccgtaacataaatataacataagtgtgagcacttttatgcaaaaaaacgatttttcgaagattttttaacgaaatttgggaaattttgaaaaatttcaagacttgttacaaaattcggtctttttgggccatttttaatccaaaaaaagcgaaaaaaaatgcaatatttcttcaaaaatatcggcaagaacgaactatttggccgggcagccgatgtagatgctccacgagctggttgtttcatcgtgagcctggaagaagtagccggacggcttgttggtgtgtacacagactgggtcatcattgatccaaccttcttcgttgttaccgccgcaggtttcgatatcgacttcgcttgtcgtgttgatggtgccgaagaagtgacatacatcgatgtagtcattgacgccatcgctggagccggacgatgagaagccggtggagctcgctgtggagtcattgagagtcgccccatttttgttgtgttgctctgaaaattgaatatattgagaaggggaagtattgtgaa