Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M01E11.4   

sjj_M01E11.4RNAiJA:M01E11.4
PCR_productsjj_M01E11.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS M01E11.4a Source_evidenceePCR536WS150 Sequence/Annotation Release
M01E11.4b Source_evidenceePCR560WS150 Sequence/Annotation Release
M01E11.4c Source_evidenceePCR536WS150 Sequence/Annotation Release
Overlaps_Gene M01E11.4 Source_evidenceePCR560WS150 Sequence/Annotation Release
Chunk_score Abs_score476
Max_abs_score476M01E11.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI55687185569867
Overlaps_transcript M01E11.4c Source_evidenceePCR536WS150 Sequence/Annotation Release
M01E11.4a Source_evidenceePCR536WS150 Sequence/Annotation Release
M01E11.4b Source_evidenceePCR560WS150 Sequence/Annotation Release
WB_DNA_textsjj_M01E11.41150tttacgatggaaggtttcgggggtgtcgacctgtaaaatagagatggttttcttctttcatcattgtgtagtttcaattcgcgtcacaaaatgattcggagaatctagttcgcattaaaaaaaaaggtaatcaatttacctccactcgttgttcattattgatagaaactccattgaatttttttcccttaacatcagcatctccgaaaagaacctcatccgcgttagcttcatactttgcaatcttgtgatggtggaacccaagaacatctctgttacggtattgttctccttgaacccattcgaaaggaattggctgatgtggattgaatcgtgatctactgagtacacggaatcctccacacacctcgacgacttctttgtgtgatccaacaaaccatccacagaccttgccatctggtttgatgaacgcatgtccgaacgcttcatagtgaacgttctctccgtattttgaccgtgtaatcctgaagagaaattaatagaatggaattcaaaaaattttagtggcaaaatgggattccattttgaaaatgacatgctattattcaatcaaatatttggttatgtgttaataataataacttgcatgcatattttttgtatcattacttcttttttttctaattttctatacttttttgagttttttcctgtggaaaactttagcggttcgtcgtgttagtaacttgaaactagatatcatgtattagtgacactgcaactttgaactaaacaaacactcatacaccacaatcatgcttttatcaatttcagatctgaggaaaaatggattcacactgaaaactaacgggtttacgctctccttcatgtccctaaatacactttttgtttaaaaaatgaatagataaattgtgtaattgatgtcctatcagcaattgaagcatgtcagaatcgaatgctggcctcggataaactgttcgacgaaacaacttttttaaaacgacgtaccagtatccaacaaacgagtttgtctgtgtatggccgttattctcattagctgggaataccaaaaagtcatctgttgtacgtccatcacgaagatctccatcaaatccaacagtcgtccagtattcttcctgaatttgagaatcgagtccacgacatcctc