Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M01G12.7   

sjj_M01G12.7RNAiJA:M01G12.7
PCR_productsjj_M01G12.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM01G12.7 Source_evidenceePCR803WS150 Sequence/Annotation Release
Overlaps_Gene M01G12.7 Source_evidenceePCR803WS150 Sequence/Annotation Release
Chunk_score Abs_score741
Max_abs_score741M01G12.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1211382512115006
Overlaps_transcriptM01G12.7 Source_evidenceePCR803WS150 Sequence/Annotation Release
WB_DNA_textsjj_M01G12.71182gacttcccaactgacttcgcatagttaagaacgtgctgacgttatattttttggagaaaaaattgccgcattttttgtagatcaaaccaatgcgtagtttgttgagatatttttattacccattgaaaaaaacagatcatagtcaaatagatcacaaaaggggaaattgtataacagtatgaaacaaaacataaaacaacatggttatagtgtcaaacaaaaaatattcagtttctagccatattcctttggtcttcgtgaaaagcttttcgttcttcccatgaaataaaccgctcgatataaaatccgttgaactctgatgtcttcattttgtgtacatttcgtaagcaccttctctgttgataaatactattcaccacaatttggagatgtcttggttggccaatgcaacgtaccgctgcaacctcgggtccgattccactaccaaggcgatcaactatcttcttcgcctttgtctcgtcactctcggtgttttcagagagatacttcacgatgagggatctctcccattcctcccgtacaggaagatacgatatgttcccatttatatccatcttgcccttactcttcaaaatgtgctcgaccacgtgtcggaacgttcctgccaacttctgatggtcctgttcaatcttccactggcttccgtcatttgtaataacatagcagtctctgtcttttttcactgagtttttgatcaaattaaagaatgactgcagtcgcttctgtccatcctcaatcgtccaatggtcttcagtgccttcaaatctcttagcaacttcttcaagaatttcttctctgctccgggtttcgatctaaaaaaaatagatcaaaaatgagaataaaaacttttgaatggaaaaaagttagctagtggacacatcacttacatcgtatagaacgttagtcggccaatcgaatttcgcatcagttatctccaatagactcggatgatttcttgaaccaatgatcagtgtcaagacgttcgagaagaatgactgccaaaacatccattgactcctccgtttccaaacatgctcagtgagtcctccctcgaataacttcaactcaacatgattattcctgtctgaaaacaagtcttgagtttagcaaaaattgtagttttttggagcaaacgcgttttatcggaggttgtgaacaagg