Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M03A8.1   

sjj_M03A8.1 RNAi JA:M03A8.1
Simmer:M03A8.1
PCR_productsjj_M03A8.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM03A8.1 Source_evidenceePCR943WS150 Sequence/Annotation Release
Overlaps_Gene M03A8.1 Source_evidenceePCR943WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRX68186106819736
Overlaps_transcriptM03A8.1 Source_evidenceePCR943WS150 Sequence/Annotation Release
WB_DNA_textsjj_M03A8.11127tgacagcgttgagtttggagacaaaatcgtaaaaaccgccatcgacaattttggaagaattggtacagttttttgataatagaatactgatggatttgaaattggttccagatattgttatcaacaacgctggtatccttcgtgacgtttctttcctcaagatgaccgagcttgattggggtttgtaatagctttcaaaaaataaaataaatctgctcaattttcagatcttatcttcaaggtccacgttaagggagcctatgctgtcaccaaagccgcttggccatacatgagagatcagaagtacgggcgtattgtggtcacctcttccaatgccggagttcacggaaactttggacaagccaactacgctgctgccaaaagtgctctcattggtctgtcaaactctctcgcccaagaaggtgcaaagtacaacattttggcaaataccctggtcccaacagccggatctagacttaccgagactgtcatgccacaggtattttgaagaatgatttttttataacggaaatctttacagaatctcgttgatgctttgaaaccagactatgtcaccccactcgtgacatacatggtgcatgattctttcgaagagtccggaaaagtttttgaagctggagctggatggtacggaactattcaatattacaaatctaaaggaaaggttatttcacacgcatcagctgatgacattgccaagaactggtcaaccatcaccaacatgaacggagccgagtacatcggaaccatcactgagcagagtgctagacttgtctcaatcctggaagagcacgaagcttcatctggaagtagcagtgcttcttctggtgcttcttctggtggtgctttcccctcaaacatcaggagtagtgcactgttccaggaaatggctgatggtgtgaaggctgacccaactgcagtaaaaactttgaaatcgattgtcctttacatcatcactgacggaaagaacgagcttggaaaattcagttagtttttgatgcgtcaattatattaaaactagtattatttcagctcttgacttcaaaagtgcatctccatccgtgtacttgggtgatgtaaagaacggagaaaaagctaacgcgacg