Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M03E7.5   

sjj_M03E7.5 RNAi JA:M03E7.5
PF:GL1_2F7
PF:GL1_7H8
PCR_productsjj_M03E7.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene M03E7.5 Source_evidenceePCR695WS150 Sequence/Annotation Release
Chunk_score Abs_score569
Max_abs_score569M03E7.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV56209685622139
Overlaps_transcript M03E7.5.1 Source_evidenceePCR695WS150 Sequence/Annotation Release
M03E7.5.2 Source_evidenceePCR632WS150 Sequence/Annotation Release
WB_DNA_textsjj_M03E7.51172gaagcagaacatgaatatcaggcaacaaattacaccgatcataaagagtttcttgtcttctcgcacacgcttttcgatgagtcgaattgtggtatcagatattcccagctgaaagattttcatctaatttattgagcgaaaccagatatacttacggatttggtcagaaaatggaatcgttttcgaatgctcagcaagttgtacttctgtttttgaagatcctcaaagacgcttgcaccttgggctagcatttgatcgatctgaaatttaatatttaatattaatttacatttatcgatttcacaaaaatttaccatattatccgagtatttcagtttatcattcaagttgagctcttcgtcaaattccagattcacacgcgtttcttgatttgttgtaaacctggaaagagttattaaaaaaactatagattatttattttaattaccaacctctgtttcagaagtgctttcttttcttctgcttgcttctttcgattagtgtgacgatttgtcattgttctcaatgaatttttgataagacacacatcacttttcaattgatccattttgaacgaagctttctgtctaactggagccggttctctgcccagttgtgattccagtcgaaacatgtgtgtttcagttttcctaaaaaaagattcttgttggaattaaataaaattatcagttttacataagactactatttgcatcctgaattaatcgatccacttcgtgatttcccgtttgacgttcaatcgcaatcaaaagtagctgaacattgtcgatttcttccctagtggccttgagttgtgtatccatcgactctaaaatataaaaataaaattcttcaaagtgaaagtactcacttttaaaattaaaaacaagaaatgccagtgaatattcagaaaatacgaaattagaaaataaaatccacgatttctcaatggcatgcctatgtgacgtcagcttacgttttttatgacgtggaacggaatcgtagtttttaaaataattttaataatcatttcttttaatttgaaagaaaattattaaattgaaacgttgaaaaatgatttcgctgaaagataaaatttgaaaaaaaattgcctcgaaaaaatctagtgcaattgcgctctatcgaacatttgttagagagtgagagacggc