Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M05B5.3   

sjj_M05B5.3RNAiJA:M05B5.3
PCR_productsjj_M05B5.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM05B5.3 Source_evidenceePCR770WS150 Sequence/Annotation Release
Overlaps_Gene M05B5.3 Source_evidenceePCR869WS150 Sequence/Annotation Release
Chunk_score Abs_score806
Max_abs_score806M05B5.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI71871597188345
Overlaps_transcriptM05B5.3 Source_evidenceePCR869WS150 Sequence/Annotation Release
WB_DNA_textsjj_M05B5.31187cattgaatgctggctctgaacttcagaagaagacatcagaggattggctttccggatttgatgacagagatggagaaagaattgatttggatgaggaaactgatgaagttgatagtgataaagttatgaagagacgcagagaatttgaggagaagaagtcttgtaaacgtggaaatgatcatgaacaggcatctagtgagacaagagtttctattgaaagtgatgctccaccaaatcctgctcctccaccatcgacaactccagaaacatcttccactactccgtcaactgtcacttcttctacttctgatcctaacgcaccaaccgcttctgacgctgcttccggaactggaactggaactgaatcgtctgatactcctgcttcatcggcaccacctacttctgcagcttccggcccaccggcaccaaagtctaatgataaggattcgacgggagataagatctatgttaagagtgaatattgtggagcaccgggagaaaaagtcactacaatctcttcaagtttgttattttttcttttcttttttcgaaattcagaaataaattttccaatgtttgctacattgcagacgtttctagtcaacaaccaaaatccaaggctccagctccacgtccatcaatttttccgtattttgttgaaccaaaagctccgagttccgatgtttcaactagtaaagcatcttcaaagatgaccaatccggatcctggaaactctggatcttcttttgctctgtgagttttcaagcctatatctagattcaaataacttaaagacttctcttcaaatattaattgaaattaagagtgtcgatattccgaattttcatttttcattgttcaacaatacaattgattggaattattcaaaactcgagcaaccattcctttttcaggtatcgcgaaaagcaaaagaagatggccactgattctgcaaaagtttacaatggacctacaaaaaaggaaaaggatccaaaatgagcatacatccagtcgagaacatttttacatttactttttttaaaatttatttttgtttcaattcgtctttaaatgatctgcgtctctcgtttttctcattatcgtaaatattttattgttgtataataaatcgcagttctctacttgtatgtcagtaatatcccagattcaccttctcaccttcaccc