Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M106.1   

sjj_M106.1 RNAi JA:M106.1
PF:GL1_6D8
PCR_productsjj_M106.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM106.1 Source_evidenceePCR911WS150 Sequence/Annotation Release
Overlaps_Gene M106.1 (3)
Overlaps_transcriptM106.1 Source_evidenceePCR938WS150 Sequence/Annotation Release
WB_DNA_textsjj_M106.11183aaatcaattcgacagggtgcgctcataatgcacattaaatccatccatctggatggctttaaatcgtaccaaaagcacaccgatattctcgatttttcgccgactttcaacgcaatcaccggtgagtatagttttgtgctgaaaactaatagtttgaaaaactttaatttcagcataaaatatagtataataattgttttatttcaggatacaatggtagtggaaaatccaatattctcgattcgatctgcttcattatgggaatcaataagctcgataatatcagagcaagtatgtggctctttctcatcacaaaattattttgttgtcatagtgatacttacgcgctttcggactgaaaaagcacaagatcagagtagcataatatttctagcaaagattttttaaattgaaatttagaaaaaaaaattaagtcaaatatcattccagaatcaatgcacgagctgatttcccatggtggaacaaaagcgatcgtccaagttcgcttcgacaacactgataaaagatgctccccgttcggaatggaacatctcgacgagatcgtcgttcagagaatcatcacagctcaagcaactggaaaaggatgtgcaacgagttacacactgaatgggcatgcggccacaaatggaaaaatgcaagatttcttccgtggcgtcggtttgaacgtgaataatccacattttctcatcatgcaaggtcgtattactacggtgctaaacatgaagccggaggaaatcctcggaatggttgaggaagcagctggaacaaagatgtatgatcagaagaagaaagacgcggagaaaacaatgtttttaaaagatgcaaaactcaaagaagttgatagaatcttccaatcaagtattgatccgagaatggtaaagttccgtgaagacagaaagaatatggtggaagtgactcgtctcaagaaactcaaagagaacttttcccgaaaatacgaggcgtttcaatactttcaaacatgtgaagcggtgaaaaaaagtgcaaaagagattgaagatgccaaaaagggaattgaagatctcggtgaaaagtttaatcagcttgatcttgacttgaagaataaggaagatgagaagaaaaagatggaagaatctcgagatgatcaacatgaagaggctgcactttcagcggctcatctttc