Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M110.4   

sjj_M110.4 RNAi JA:M110.4
Simmer:M110.4
PCR_productsjj_M110.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS M110.4a Source_evidenceePCR1960WS150 Sequence/Annotation Release
M110.4b Source_evidenceePCR1957WS150 Sequence/Annotation Release
Overlaps_Gene M110.4 (3)
Overlaps_transcript M110.4b Source_evidenceePCR1957WS150 Sequence/Annotation Release
M110.4a Source_evidenceePCR1960WS150 Sequence/Annotation Release
WB_DNA_textsjj_M110.42164gatatcaaaacgatgcgagtttctgataataagaagcctaatttcacaccaaactgggcaaacaaaggaggaaaccgccagcaggttgtaagttatcattatttaataaaagccataattcaaacaatattgtattttcagccataccgtggaagaacaaccacagatggaaccgggcgtggcggtcagcagcaaagagatcgtatgcacaacaagcgaccaccagttgttagaccttcgattgaacgagttcagagagttacacttccatcatcgaaagatgcatggaagccagaccgtcaaaaaaccgcggaagctgttgcaagcgaggaagctgcggttattgtaagttattcgtgattaatcaaaactataaactgttaaaccaaatttcaggaagtttgtaagaaggttcggtctcttatgaacaaggtgacgcctacatcacaacgtcctctcaccgaagaattcatttcctacaatgtatcctccaacgatgcgcagctcgctcaagttgtcgaaatcgtctttgacaaggcagttgaagagccaaagttctgtgctttgtacgctgaaatgtgtaaggctcaggcgaatcatgaactatcccagaccggcggaaagtcagccttcagaaataaggttttgactcggacgcagatgacattccaggataaaaaagacattgatgcagacaaactggcaatcatcgaaaaagaagaagatccagtgaaaaaggaattgatgcttgcagaggagaaacagaaatttagacggagaaagttcggagttatgacgtttatgggttatctgtatagaaatcaacttttatccacaaaaatcgtccaaacgtgtacattcgaattgttcaattcgatcaaggaccaagatattaaaaaagaggatgtcgacgaggaatctattcactgtggtcttcaactcatcgagactgtaggcgtgatgttggataaatcaaaagattccacgaccgtattccttgatcaatggttccagaagttggaagctgccaaaccttactgctcaaacaaaatccgtttcatgatcatgaatcttatggagcttcgcaaagacaaatggattccaagaaaatctaccgagtctggaccgaaaaaaatcgatgaaattcacaaagatattcgtcaagagaagattgaaaatgagaaagctcgtgatcaatatgatcgggatcgtgatcgtcgtcatggaggtgtcagaccaaacagcaactctctcagaaaatcagttccagtctccaggaattcattggataggaaccgaggaatgcaacaccctgaacaaaaaagagccgctgctgcagctaacacaaaacttgcctcatcgagtaagtattttcagacaaatatttcttcaatattaattaattgcaatttccaggtgttcaacccaaaaacatctcgctctcttcgatggataataatactcttgggaagagcaaaaaagagtggcattctggtgcttctggtggaggaaacacttcttccgaatctgccgttccagtcaaatcagcttgggggcgacgtgattccaatgatcaacgcaaaaagtcgactgttgacgagaaacaggccgctttagctgctgcaaaggaaatcagtgcaatgtcaatttcttcgcggcgatccacatcacaaaattcgaatactgacaagaccgacgatgagctgactgaagaagagaaagctgtcagagccaagattatgaataccgttaaatccgatcttctagaaatgtctagtggtgagctctcccaaaaggaattggttgactctatcaccgattatgttggaaaagaaaaatacggttcgccgtcattgacagtagtctatgagatgattatccgagctgtgatcgaaaaaggtttgaaggatgatgatcgaaagaagttggctattgctctgcggatgtcattggtcagcaagactgagaagcaagcttttatagaggggtaaggcaagagtttatgatttattgagctttacaaattatttcagagctacccgtttctgcaaattcgctaatgatgttgagctccagcaagattatcccaaattgtggaccgttactggtgaagttctcgtgaacacaagtcatgctccacatgacgaaattggagaagttgaat