Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_M28.5   

sjj_M28.5 RNAi JA:M28.5
Simmer:M28.5
PCR_productsjj_M28.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene M28.5 Source_evidenceePCR492WS150 Sequence/Annotation Release
Chunk_score Abs_score450
Max_abs_score450M28.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1065797010658777
Overlaps_transcript M28.5.1 Source_evidenceePCR492WS150 Sequence/Annotation Release
M28.5.2 Source_evidenceePCR490WS150 Sequence/Annotation Release
WB_DNA_textsjj_M28.5808atgtatttgcaatttgggacaacaaaacaatgaatggattatcatataacaacaatgaggtaacgtaacaacaaattgataaaagaaggatttagatgagaagcttctcaacgtcctccttgatcttctgaatttgagatttgagctgagatccttcgttttgagtgattgaagcagcgatcactggacgagtgactccacaagcgcgtccgagggcagccttgctgcgaacaaagacgtatggaacgttcttgtcttcgcagagaagtggaagatggaggagaatctccagtggctcggcatcggcggccatgacgatgatctgaaacaattcaattaatttggttcgaaaattgattttgaaaatgggaatgcaattcaacatggttacgatacacttacctcagagattcctctgttgagagtcttggtggcctcgttggctcccttcttgagctgtttgtagttcatcgcttgctggacgagatccatgagcttttgagacaagttggtatcggccagtgggaaggccttcggattgactccatcatcggccatttttcttcttttctgaaataaagatggttgaaaattgctacaatgcgaaagaattatttatcgattcaagagaaaaaataataaaaacgatttcaaagctgtaaattcaaatttttacgatgatttgcactagtaacatatctgaaagtaatagataatcaaaattccatttatttttaatttattgtaccaacttatttaatttccgaagaaaaatacaacgggcaacgggagaaacaaaagaaaagag