Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_PAR2.3   

sjj_PAR2.3RNAiJA:PAR2.3
PCR_productsjj_PAR2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSPAR2.3a Source_evidenceePCR607WS150 Sequence/Annotation Release
Overlaps_Gene PAR2.3 Source_evidenceePCR607WS150 Sequence/Annotation Release
Chunk_score Abs_score544
Max_abs_score544PAR2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII87584748759557
Overlaps_transcript PAR2.3b.1 Source_evidenceePCR607WS150 Sequence/Annotation Release
PAR2.3a Source_evidenceePCR607WS150 Sequence/Annotation Release
PAR2.3b.2 Source_evidenceePCR607WS150 Sequence/Annotation Release
WB_DNA_textsjj_PAR2.31084attggagtcggtttgctacgaacaataatatgatacatactgagtactttccattccatatcaacagattttaaactcaaaaaaacatgtttcatggtctcaactggatcaagacatgcacgaattccaagattccatgtcaatttcttttgctcttttttcagtccttccaagatttttcgaccaacatttgctgaaaactttccgactacttttgcaacattcctttcagatttctcacttttcgtggtggcaccgactggcaacgaagtgcttcccattttcattgtttttccaatctcccaaaaatcttccattgctttttgagaagattcatcggcatttcttttatgatttacttcaagacgatatgcaatacagagaaaatgatgatgatcttcagcaagtagagctccagttacatcttcttctttcacatcaaatttctgaaaaaaaaaggtttcaggtgttgctgtcggttaaaaaaaaattcccatgatttcctgtcttttttctattttttaaaaataaattttcatcttaactcatggaagtatataatttataagaatttatagttttttcgtacatttttacttttcggttctcgatttctcgatgaaaggggattttgcttcttaaaatataaaatagcttcaaattatgaaaaaaccaaaaaatgtcgaaaaatgaaaaaataaattattttttctggtggggttttctgaatttcagtttttttgtatattttaacaataaattcacttaaaaaaaataatcagaaattattgtaatagtattctagaaccaaaaaatgtgaaagtttaatttaacttttttagaaactctcagaatattttttaaaagtcgaacctctgcaacactctgaaccacatcaatatcaacaatcgatgattcattttcacattctgggaacaaataatatggaagatcgatacggaaccaactgtgattaacaattcgttttacatcagctctcttcacaggatcaacttgaagcatcgtagaaattagatcggctgcttgtttttccatggaatatggaactgtgtatcggccacct