Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R01H10.3   

sjj_R01H10.3RNAiJA:R01H10.3
PCR_productsjj_R01H10.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS R01H10.3b Source_evidenceePCR805WS150 Sequence/Annotation Release
R01H10.3c Source_evidenceePCR805WS150 Sequence/Annotation Release
R01H10.3d Source_evidenceePCR805WS150 Sequence/Annotation Release
Overlaps_Gene R01H10.3 Source_evidenceePCR805WS150 Sequence/Annotation Release
Chunk_score Abs_score742
Max_abs_score742R01H10.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1025071410251815
Overlaps_transcript (5)
WB_DNA_textsjj_R01H10.31102accagccgatctatgtttggacattttgttagagtactatatgattactgtactaccagaatctagaatatccctacagtaacccaagtaaaaatgaatttactgtaattttactttccaggcggagaaaacgtaatgtttatgtggaacgttggaaccggagaggcactcctcgaaatctccgggcaccccgatcaaatctggagcatcaacttcaactttgacggtagtcaatttgtgactacctgcaaggacaagaagatccgtattcttgactcacacaccggagaggttgttcacgagggaatgggtcatgagggtgtcaagccgcagcgagccatttttgtgaaagatgggctcattttgagcacgggcttcaccaaaagatccgaaagattgtatgctctccgagccccggaagatctgtcaaccccaattgtcgaagaggagctggatacctcgaatggagtcgtcttcccgttttacgatgaagattccggtttggtgtaccttgttggaaagggagattgtgctattcggtactatgaggttaacaacgatgctccgtacgtacattatattaatacttacactacaaatgagccgcaaagagctgttggattccagtcgaagagaggaatgtcgtcggaggagaatgaaattaatcggatttataagttgactacgaagggagttgtggatattttgcagttctttgtaccgcgcaaatcggatcttttccaggtatgcggagttttgaaataaggttttgttctgaaaagttgtaggttaacaattttggctcgaaaaattattttgaaaaatttcctacaattttttaactgaacccatattccagcacgatctctatccggataccagatccaccatcccagcccttaccgcagaagagttcatggaaggttggctggaaatttctttattttttaattgtccagtgtatttttcaggtaaaaatgctgcaccaaaccgtcagccagtaaatgcagccgctgctgcagctgccgccaaaccaaaggtccaggtagccaagaaagccaatattttgagcactttggctccgactgcgtgagtttttgaa