Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R01H2.3   

sjj_R01H2.3 RNAi (5)
PCR_productsjj_R01H2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR01H2.3 Source_evidenceePCR1041WS150 Sequence/Annotation Release
Overlaps_Gene R01H2.3 Source_evidenceePCR1041WS150 Sequence/Annotation Release
Chunk_score Abs_score978
Max_abs_score978R01H2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII70592207060356
Overlaps_transcriptR01H2.3 Source_evidenceePCR1041WS150 Sequence/Annotation Release
WB_DNA_textsjj_R01H2.31137actgctgggcaagtgaaagtgtgctttgggtcgcatttcgggcaattaagctcacaagcttcaactaatccagaacaagcttctacttctgagtattgattgccatcatcgcatgttaaaagtttcaattttgatgagaaccgttcattggagcacgatcctggacagttttcctcgtcgattccgtccaaacagtcgtgttttccatcacaaacttgggagcgcataatgcatgtaccgtcttcgcaaagggctttctcagaaccggaacacgttttgcaatcacattggtgctcgtctgaaccatcatcgcaatcagggatgccatcgcagactttgctggcttttatgcagttctttccgcatttctgaaatttgtatattcattttatgtattctatttataataaagcccacgtgtgctcctttctgacacttattacagttactttcgtcactttcgttttcgcagtctgaaactccatcgcatttgacagaaattggaagacatgcatcgcttcctgagcatttgaattgatcttttgagcatttggacctgcacgaggcttcatccgaaccatctgggcaattttctacaccattgcagagcttttcagcggttaaacaaataagtgttggcagaacagaagtcttgtcctttttttcggattcttcctcgatatgagcccgacaagagtagattgactgacactccttacaattttcctcgtcagaaccatcagaacaatcttttaaaccatcgcaacgcttcgatgatggaataatcatgtcaattgagcctgtacacgcgaatccaaatccggaacatgttgacacatttggcggtaaaagtgacgtcatctgaatggcactgagatcatcgtcctgaactttttctgttttcggccagactttgggatgacgaatcgagtgagaagaaaggtctctggtgccggatgacatggcttgagccgatggcgacaaaaagatgacaagtggaacggcaataatgactcccaaaataatgagagcaacaataagaacgatggcaaccgggggaaactgaaaaattgctgataattaaaagtctttaattccaaacttctaacctttccagcacaaggacacgagcttgaa