Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R03E1.1   

sjj_R03E1.1 RNAi JA:R03E1.1
Simmer:R03E1.1:Repeat_a
Simmer:R03E1.1:Screen
PCR_productsjj_R03E1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene R03E1.1 Source_evidenceePCR961WS150 Sequence/Annotation Release
Chunk_score Abs_score899
Max_abs_score899R03E1.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1416722414168386
Overlaps_transcript R03E1.1.1 Source_evidenceePCR961WS150 Sequence/Annotation Release
R03E1.1.2 Source_evidenceePCR961WS150 Sequence/Annotation Release
WB_DNA_textsjj_R03E1.11163ggtcaacagacgaggagagcttatccgatttgttggttctcaactcatcgtttgacaagcttcgcgaattgcgattggttactgttttagccggactcaaactattcactgactccaatgccccaaatgatttggacgatgatggcgcttcttctggtattggatcggggattctgattgcaatttgtttacattccgcttctgaagctgaagatggcgaagatgcagtagaattggatgccgacggtatagtctctaagctcattgtgtcaacattctgacagtcactgagattatgtgctgtttctacatcagttgtgatttgacgaattacttcttcggcgacaacgttgcgctcctcttcttctccggttgcttcacggcctccaagagcaagcgcgttaggtgggaatggaccagtctgaaattattcgtttataagataacgtatttctttgaaaatatttataggtttaccttcattgcctttgcaattgtcaatcctctatcaatcgagtttgacttcctatgtccgttcacttctttaacatccggcgtcgttgaagccatcagtgcatccgagctcttagaggaaccaactgaaatctcccgctgtattagatttttctttcgttcctcttctatccggttttccacctcaaatgcaatcggatctggaagcttcattgatggtgttcggggtggcagaggtggtggacatcgtggcattggtgctaccggaggatgggttaagggagattggactggagacattactggagctcttgatggaattggtggtggtactcttgtgctaggcgagatgcccgagcatgagctatccgtgggagtccatgtggaagatcgatgacgggattcatctataggtatattcactttcatcggcgtaattgttgcatttgctgatgtgttactctggcttattaaagagttctcgaatcccatttcagaacgtggcgctgcacaagagcttagtgtatccgtcgcgtttactatctgaaatttgataaatagtaaaaataaaccctggcgggaaaatgcgaaatttgaaatttcatagaaggttgcactattttaggcctatagacaataatttaaaaatgatatgcactgtgtacatttgcgtgtctgtgtcaattgct