Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R03E1.2   

sjj_R03E1.2 RNAi JA:R03E1.2
Simmer:R03E1.2
PCR_productsjj_R03E1.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene R03E1.2 Source_evidenceePCR930WS150 Sequence/Annotation Release
Chunk_score Abs_score846
Max_abs_score846R03E1.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1416330814164419
Overlaps_transcript (2)
WB_DNA_textsjj_R03E1.21112tgatggaatccttctctgggtcgattgaggccattcccacaacaatgtagatgagagcctgaaattaatggcattttttggagttaacatcagttatatgatgaacattattctgtaattttctacttaccacaacaagaataacaactaatccaaggaagatagcaaagattgctggataatcagaggacactggaacagtcacttggaggttttcgcgagctaattgggttggcgtttttgattttgtgtctctcttctgaatgttatggtttggaatttcgcgagactcggtgcttttctcggcggctccggattcagcttcgaatgcaagaagctcgatgacagcttgtccaccgtaagcattgttgatggatgcagtgagagcctcaatggcggccttaacgtctgcgacagcttcttccttttgggcagattcggtgattccgacaagtccggtgatggagacactacaataaaaaaataatgtgaaacaaagattccgggatctaacagaacttaccggaaaacatcagcattgttatccatttgtactccggcgctcttgatggcagcggcaagttgataaacagcctcaagttctttgacaagtgtgcttctcttggtcttgattacagtagcatcaacggcttcttgttgggcggcaagagcgagcattgatccggtaattccaccagccgaaacttgcacattttcacggtcggctccaaagatcagcgccatgtcttgatcgaatccaacattctcaacaccgtcggatttggttgagtaggtttttcctcccaagttcaggttgtcagctccaattacagttacgacggcaagggcgcgtggacgagagaacatgtcaacggagaccgaaaatcctgaaaaacgattcatcttctttgctttatatgtaaagtaactatatcactactcaccatcaacttgtcttgcagaaagtcccagaatgttctcattgagagtggaaatcagtgtggtcttcaaggttgcgtcagcatccgggaacttaagggaagccggagctgcgataatttccagagaagatgcggcacacgcggcgaccagagcggagacgagaagaacaa