Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R04A9.4   

sjj_R04A9.4 RNAi (5)
PCR_productsjj_R04A9.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR04A9.4 Source_evidenceePCR687WS150 Sequence/Annotation Release
Overlaps_Gene R04A9.4 Source_evidenceePCR812WS150 Sequence/Annotation Release
Chunk_score Abs_score728
Max_abs_score728R04A9.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX381263382754
Overlaps_transcriptR04A9.4 Source_evidenceePCR812WS150 Sequence/Annotation Release
WB_DNA_textsjj_R04A9.41492cagttctcatcaaatcatggacacgttataagtcagtttgtagtttttgaaaaaaaaaatccagaaaactaagtgatgataatacactctttttttattcagttgaaggaaaacacagatataaaacattcgttcatttccgcaagccaaccaaataaaaacatttcaacaagtgaagaacatgttaaaatacgacgtgaatacgcattaggatttaaaaaaaaacaagatatatgttaataaaaataacgcatcaaaaagaaatttaagtggctggtgtggcaggagtctcggttgagactggaactggggctttctcctcgcgtggctccaccgcgtaaatggcgtgcttcgctttgactcctgagctcgtcttcttctggcaactctcatgatcctcataacggagaacgtcgtagagtggtctctgatggatcatgcttgcattgttgagcacttgcttcaagacgcctctgcaaaattgaaagtttcactttagttactctacagttgcctgtcaattttacatgtaccgctgctttaacataattttggaatttcgctgaccattaagcaatcaaattctgtggtacatatgaaagatgcgctagactggtttcataaccaataacgttatgtgttgcaaacggttagcagtggaaaattgtttttgaacggatgaattgcgtcttgtaacacccagaagttgtctgtggctcaatcaaatgtaatgatcaactagactagtttcataaccaataacgttatttctacaacctcattagtttttagactataaaaacctacccaattctcagatttgccccgtcatcagcactgtttgtagtccaaactgagatttttgagccctttccacggacgttgcagacaattccgcacagactttcgatatcgtcggaaaactgctctccgatcatcgccataagaatttcggtccagatagtgtccatgatttccggagtgcgtcctttctcgatagtgataagccatcttcctccattctgattttgtggcacctgaaaacacattggaatgtgtttatgaaaatatttataccacgtgtgcatcagcgcaaaaatcaaaaaaaaaattcacctcccacattggctcaattccatctctgaaaacattataatctgatggtggattgagcccacttggcggcttaatagagtcgtgaagtgcccagaactctccgacgctgctaaaggttttcacgttcttgagacgctcctcccacgatttgttgcgctcgtcgttcagatacctacaaattcgtttattccttatgttcaaaaatttattcaaaatcttgatgcctagggaaaagtgtcaatagcttaccaccaggtccagttgcgtttcagtttgtaaactgggtgggagatggttccaggagctgcgactggttcttcggacattacttgctgaaaagaaaacaatatgtgtggcaaaatatcaggcagtagtt