Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R05D11.3   

sjj_R05D11.3 RNAi JA:R05D11.3
Simmer:R05D11.3:Screen_A
Simmer:R05D11.3:Screen_B
PCR_productsjj_R05D11.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene R05D11.3 Source_evidenceePCR487WS150 Sequence/Annotation Release
Chunk_score Abs_score403
Max_abs_score403R05D11.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI85908978591819
Overlaps_transcript R05D11.3.1 Source_evidenceePCR487WS150 Sequence/Annotation Release
R05D11.3.2 Source_evidenceePCR484WS150 Sequence/Annotation Release
WB_DNA_textsjj_R05D11.3923ttaaacttcccaagaacgaacaaaacgcaggaagacaatactgttctttcgaaaactgaaacatgaggccgagggtttaaactttaaaaactaaaaaaaaacaatttggttgctgtttatttttctcaatgcgagcaagaccactgctcatctaacaactaattttcaaaatttattgagacaacccatctcgagtaaatatataattcaattgtttcgaaaattatcgtattcttcgttgctttttcctacctatcttatttatttttactctttttcaattatttttcccaatttgtcgtttttaaaggaatgagcttcaatcctgattacgaaagtgttgcaaaggccttcattcaacattactactcaaagttcgatgttggcgatggaatgagtcgtgctcaaggtatttcgtctgaaaaaaacaataaacttagtgaatttcaggactctccgatttgtacgacccagaaaactcttacatgacttttgaaggacagcaagcgaaaggccgtgacggaattctccaaaagttcacggtttgtgcaaaagtacgagagttcaataacgaaacacttttagactctcggattcacaaaaattcaacgagcgatcactgtgattgactctcagcctctgtatgatggatcaattcaagtgatggttcttggtcagctcaaggtaagtagaagtagttttcaaaaaaaccgaaaaaaaattattcagaccgacgaagatccaatcaatcccttctcgcaagtctttattctccgtccaaacaatcagggttcctacttcatcggaaacgagatcttccgacttgacttgcacaacaattagatatcaattcgtccactttcctatcaaaatgtgtccccgtattgaacaatttttcaagaactgaattttcaccaaattgc