Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R05D11.4   

sjj_R05D11.4 RNAi JA:R05D11.4
PF:GL1_6E11
PCR_productsjj_R05D11.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene R05D11.4 Source_evidenceePCR1042WS150 Sequence/Annotation Release
Chunk_score Abs_score979
Max_abs_score979R05D11.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI85998068600942
Overlaps_transcript R05D11.4.1 Source_evidenceePCR1042WS150 Sequence/Annotation Release
R05D11.4.2 Source_evidenceePCR825WS150 Sequence/Annotation Release
WB_DNA_textsjj_R05D11.41137acacgtgtcgcattcttcagtgccacattttcacatgaagttgaaaaatggtacgttttcgaagatttgtcatatcaaaattccatatctaaattccaggtgtaaggagaatatcgatgaaattggtatggtatgtgttggtgaacgaaactcgtctaatacaagtgtgaagcaaaagttaacctattgtggaactgaagatggaaagaaaatcgctattcgaaatttgttgcgaacttccttcaaaccaccagctctagtttttgtacaaagcaaggatcgtgccgtgcaactggtgaaattactgtctgcaattgattcaaatctaaaagttgattcaatcaacagtggaaaaagtgataaggaaagggatgaaacgatggaaaggttccgtcgaggagagatatgggttctcgtttgtactgaattacttggaagaggtcttgacttgtctgatgttggattggttatcaattatgatttgccaacttcaattgttagctacattcatcgtgttggaagaactggtcgtgctggaaagagtggtcatgctgtcacatacttcacagatgctgatatgaagtatattaaatcaattgcaactgttatccgtcaatctggttttgatgtgccggagtatttaatggaaatgaaaaaagtctcgaggtttgagggtaatcctattgttctgagtactcaatttttaattcagagatcgtaaaaaggatatgctcaaacatgctccaaagcgtcacaaaatcgccattgtaaaagagcaggtgatcaagaagaagaaaatgttagcaaaggcagccgctgaggaaaaagcgaagaataaaactgaaacacagacagcggagaaaccagagaagaaaatcaagaaaaagaagttgatcaagaagaacaataagaatatataaatgttttgcgaattttgcgctcaattgttttgttgtttcagttgaaaattgttaggatttttttgtttttttgttgttttgctgtttttcgttgttgaaataatcgagtccaatttaaaagttttaccattatctccattttatccagaacatagtgtttttaagttgattataatgtatttttcattgaaactatattttaattcacgccgaagct