Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_R05D11.8   

sjj_R05D11.8 RNAi JA:R05D11.8
PF:GL1_8E3
PCR_productsjj_R05D11.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR05D11.8 Source_evidenceePCR762WS150 Sequence/Annotation Release
Overlaps_Gene R05D11.8 Source_evidenceePCR762WS150 Sequence/Annotation Release
Chunk_score Abs_score636
Max_abs_score636R05D11.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI86027488603743
Overlaps_transcriptR05D11.8 Source_evidenceePCR762WS150 Sequence/Annotation Release
WB_DNA_textsjj_R05D11.8996acatcactcgacaccatccaagctgactcttgcgaagaaacagagccgtcaatcaccaatgcacaatggattctctcatgtatgataaatctatgatatatttcttttaccaataacatatttcagacagctgaagaaatttcagcaacaccacatttccaaagtttcgatcgccaagttccgaacccaaaagttttgagcacaatcgcttcgaatgggggaagatgttcgaagaagcagggttagaattctaataatttgaaaatcaaaatataagtttcgattttcaggaccgtctggaaatccagttcttgacgctctcaatcactacaagggaattggtggccgaaacaagaatgatctcgctgatccaatcgattttgatttggattcagattttgattttgcggaaaatttgaaattattcgagaaagatgtgagattcttcatgaaattttcttgttttaaacaaatattacaggagaatgatgaccagtactatgagacagttgaaaaatttaaatgctctcaaaattttgctcactacgaaaatataattgacgatgagaatcgagtgacctcgtggacaaatttgaaggcacgatctgaacttgtgaagacaggaacgacacctcagacatctgagttagttatttaatgaatattatgaaaatagttgtaataattctagaaagaacaacttccgagttactgctgtgagttttgagaagtcgattattggagatccaattcctgcaataagtttgaatgaaaagaaagaatttttgaatgtgagagatttccaataaattagtatataaaattgatgttcttttaggaatgtagggtttcgttaggagaagctgtctacgacacaatcgtcgccgatcgcatcttccaatgggtctcagaagttcaaaattcgtatggtgatgcacatggaactgtagttcttctcgcatcttctgcaaactctgttcgttccattcgtcgtct